SCOP Search:   
        by sunid, keyword
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(use 'Shift Left-Click' to collapse/expand all levels downwards; use 'Control Left-Click' to collapse/expand all levels upwards)
 
(-)
Class: All alpha proteins (14657)
(-)
Fold: DNA/RNA-binding 3-helical bundle (1299)
(-)
Superfamily: ARID-like (14)
(-)
Family: ARID domain (12)
(-)
Protein domain: automated matches (5)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
2LI6A:1H, 13C, AND 15N CHEMICAL SHIFT ASSIGNMENTS FOR YEAST PROTEIN
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
2CXYA:CRYSTAL STRUCTURE OF THE HBAF250B AT-RICH INTERACTION DOMAIN (ARID)
2EH9A:CRYSTAL STRUCTURE OF THE HBAF250B AT-RICH INTERACTION DOMAIN (ARID)
2KK0A:SOLUTION STRUCTURE OF DEAD RINGER-LIKE PROTEIN 1 (AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN 3A) FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4394C
4LJXA:; B:CRYSTAL STRUCTURE OF AN AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN 3A (ARID3A) FROM HOMO SAPIENS AT 2.21 A RESOLUTION
(-)
Protein domain: DNA-binding domain from the dead ringer protein (2)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (2)
1C20A:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN FROM THE DEAD RINGER PROTEIN
1KQQA:SOLUTION STRUCTURE OF THE DEAD RINGER ARID-DNA COMPLEX
(-)
Protein domain: MRF-2 DNA-binding domain (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1IG6A:HUMAN MRF-2 DOMAIN, NMR, 11 STRUCTURES
2OEHA:1-107DETERMINATION OF THE THREE-DIMENSIONAL STRUCTURE OF THE MRF2-DNA COMPLEX USING PARAMAGNETIC SPIN LABELING
(-)
Protein domain: SWI-SNF complex protein p270, SMARCF1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1RYUA:SOLUTION STRUCTURE OF THE SWI1 ARID
(-)
Protein domain: Transcription regulator Adr6 (Swi1) (2)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (2)
1KKXA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF ADR6
1KN5A:SOLUTION STRUCTURE OF ARID DOMAIN OF ADR6 FROM SACCHAROMYCES CEREVISIAE
(-)
Family: automated matches (2)
(-)
Protein domain: automated matches (2)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
2LM1A:SOLUTION NMR STRUCTURE OF LYSINE-SPECIFIC DEMETHYLASE LID FROM DROSOPHILA MELANOGASTER, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET FR824D
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2EQYA:SOLUTION STRUCTURE OF THE ARID DOMAIN OF JARID1B PROTEIN
(-)
Superfamily: C-terminal effector domain of the bipartite response regulators (45)
(-)
Family: automated matches (19)
(-)
Protein domain: automated matches (19)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2D1VA:CRYSTAL STRUCTURE OF DNA-BINDING DOMAIN OF BACILLUS SUBTILIS YYCF
(-)
Deinococcus radiodurans [TaxId: 1299] (2)
3Q9SA:123-212CRYSTAL STRUCTURE OF RRA(1-215) FROM DEINOCOCCUS RADIODURANS
3Q9VA:; B:CRYSTAL STRUCTURE OF RRA C-TERMINAL DOMAIN(123-221) FROM DEINOCOCCUS RADIODURANS
(-)
Enterococcus faecalis [TaxId: 226185] (1)
2HWVA:CRYSTAL STRUCTURE OF AN ESSENTIAL RESPONSE REGULATOR DNA BINDING DOMAIN, VICRC IN ENTEROCOCCUS FAECALIS, A MEMBER OF THE YYCF SUBFAMILY.
(-)
Escherichia coli K-12 [TaxId: 83333] (1)
3ZQ7A:THE STRUCTURE OF DNA-BINDING DOMAIN OF RESPONSE REGULATOR FROM ESCHERICHIA COLI K-12
(-)
Helicobacter pylori [TaxId: 85963] (3)
2HQNA:STRUCTURE OF A ATYPICAL ORPHAN RESPONSE REGULATOR PROTEIN REVEALED A NEW PHOSPHORYLATION-INDEPENDENT REGULATORY MECHANISM
2HQRA:118-223; B:118-223STRUCTURE OF A ATYPICAL ORPHAN RESPONSE REGULATOR PROTEIN REVEALED A NEW PHOSPHORYLATION-INDEPENDENT REGULATORY MECHANISM
2K4JA:ARSR DNA BINDING DOMAIN
(-)
Klebsiella pneumoniae [TaxId: 1185418] (1)
2M87A:STRUCTURAL BASIS OF DNA RECOGNITION BY THE EFFECTOR DOMAIN OF KLEBSIELLA PNEUMONIAE PMRA
(-)
Klebsiella pneumoniae [TaxId: 573] (1)
2JZYA:SOLUTION STRUCTURE OF C-TERMINAL EFFECTOR DOMAIN OF PUTATIVE TWO-COMPONENT-SYSTEM RESPONSE REGULATOR INVOLVED IN COPPER RESISTANCE FROM KLEBSIELLA PNEUMONIAE
(-)
Mycobacterium tuberculosis [TaxId: 1773] (3)
1ZLJA:; B:; C:; D:; E:; F:; G:; H:CRYSTAL STRUCTURE OF THE MYCOBACTERIUM TUBERCULOSIS HYPOXIC RESPONSE REGULATOR DOSR C-TERMINAL DOMAIN
1ZLKA:; B:CRYSTAL STRUCTURE OF THE MYCOBACTERIUM TUBERCULOSIS HYPOXIC RESPONSE REGULATOR DOSR C-TERMINAL DOMAIN-DNA COMPLEX
3C57A:; B:CRYSTAL STRUCTURE OF THE MYCOBACTERIUM TUBERCULOSIS HYPOXIC RESPONSE REGULATOR DOSR C-TERMINAL DOMAIN CRYSTAL FORM II
(-)
Mycobacterium tuberculosis [TaxId: 83332] (2)
2OQRA:129-226THE STRUCTURE OF THE RESPONSE REGULATOR REGX3 FROM MYCOBACTERIUM TUBERCULOSIS
2PMUA:; B:; C:; D:; E:; F:CRYSTAL STRUCTURE OF THE DNA-BINDING DOMAIN OF PHOP
(-)
Staphylococcus aureus [TaxId: 1280] (2)
2RNJA:NMR STRUCTURE OF THE S. AUREUS VRAR DNA BINDING DOMAIN
2ZXJA:; B:CRYSTAL STRUCTURE OF YYCF DNA-BINDING DOMAIN FROM STAPHYLOCOCCUS AUREUS
(-)
Staphylococcus epidermidis [TaxId: 176280] (1)
4IXAA:; B:STRUCTURE OF DNA-BINDING DOMAIN OF THE RESPONSE REGULATOR SAER FROM STAPHYLOCOCCUS EPIDERMIDIS
(-)
Streptococcus pyogenes [TaxId: 1314] (1)
3RJPA:CRYSTAL STRUCTURE OF THE DNA BINDING DOMAIN OF COVR FROM STREPTOCOCCUS PYOGENES
(-)
Family: GerE-like (LuxR/UhpA family of transcriptional regulators) (11)
(-)
Protein domain: Germination protein GerE (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1FSEA:; B:; C:; D:; E:; F:CRYSTAL STRUCTURE OF THE BACILLUS SUBTILIS REGULATORY PROTEIN GERE
(-)
Protein domain: Nitrate/nitrite response regulator (NarL) (5)
(-)
Escherichia coli [TaxId: 562] (5)
1A04A:150-216; B:150-216THE STRUCTURE OF THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL IN THE MONOCLINIC C2 CRYSTAL FORM
1JE8A:; B:; E:; F:TWO-COMPONENT RESPONSE REGULATOR NARL/DNA COMPLEX: DNA BENDING FOUND IN A HIGH AFFINITY SITE
1RNLA:155-216THE NITRATE/NITRITE RESPONSE REGULATOR PROTEIN NARL FROM NARL
1ZG1A:151-216; B:151-216; E:151-216; F:151-216NARL COMPLEXED TO NIRB PROMOTER NON-PALINDROMIC TAIL-TO-TAIL DNA SITE
1ZG5A:151-216; F:151-216; B:151-216; E:151-216NARL COMPLEXED TO NARG-89 PROMOTER PALINDROMIC TAIL-TO-TAIL DNA SITE
(-)
Protein domain: Quorum-sensing transcription factor TraR, C-terminal domain (2)
(-)
Agrobacterium tumefaciens [TaxId: 358] (2)
1H0MA:170-234; B:170-234; C:171-234; D:170-234THREE-DIMENSIONAL STRUCTURE OF THE QUORUM SENSING PROTEIN TRAR BOUND TO ITS AUTOINDUCER AND TO ITS TARGET DNA
1L3LA:170-234; B:170-234; C:172-234; D:172-234CRYSTAL STRUCTURE OF A BACTERIAL QUORUM-SENSING TRANSCRIPTION FACTOR COMPLEXED WITH PHEROMONE AND DNA
(-)
Protein domain: Response regulatory protein StyR, C-terminal domain (2)
(-)
Pseudomonas fluorescens [TaxId: 294] (2)
1YIOA:131-200CRYSTALLOGRAPHIC STRUCTURE OF RESPONSE REGULATOR STYR FROM PSEUDOMONAS FLUORESCENS
1ZN2A:131-200LOW RESOLUTION STRUCTURE OF RESPONSE REGULATOR STYR
(-)
Protein domain: Transcriptional regulator RcsB (1)
(-)
Erwinia amylovora [TaxId: 552] (1)
1P4WA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF THE ERWINIA AMYLOVORA RCSB PROTEIN
(-)
Family: PhoB-like (13)
(-)
Protein domain: OmpR (3)
(-)
Escherichia coli [TaxId: 562] (3)
1ODDA:OMPR C-TERMINAL DOMAIN (OMPR-C) FROM ESCHERICHIA COLI
1OPCA:OMPR DNA-BINDING DOMAIN, ESCHERICHIA COLI
2JPBA:SOLUTION STRUCTURE OF OMPR-C DNA BINDING PROTEIN
(-)
Protein domain: PhoB (5)
(-)
Escherichia coli [TaxId: 562] (4)
1GXPA:; B:; E:; F:PHOB EFFECTOR DOMAIN IN COMPLEX WITH PHO BOX DNA.
1GXQA:CRYSTAL STRUCTURE OF THE PHOB EFFECTOR DOMAIN
1QQIA:SOLUTION STRUCTURE OF THE DNA-BINDING AND TRANSACTIVATION DOMAIN OF PHOB FROM ESCHERICHIA COLI
2Z33A:SOLUTION STRUCTURE OF THE DNA COMPLEX OF PHOB DNA-BINDING/TRANSACTIVATION DOMAIN
(-)
Thermotoga maritima [TaxId: 2336] (1)
1KGSA:124-225CRYSTAL STRUCTURE AT 1.50 A OF AN OMPR/PHOB HOMOLOG FROM THERMOTOGA MARITIMA
(-)
Protein domain: Probable regulatory protein EmbR (2)
(-)
Mycobacterium tuberculosis [TaxId: 1773] (2)
2FEZA:10-104MYCOBACTERIUM TUBERCULOSIS EMBR
2FF4A:10-104; B:10-104MYCOBACTERIUM TUBERCULOSIS EMBR IN COMPLEX WITH LOW AFFINITY PHOSPHOPEPTIDE
(-)
Protein domain: Response regulator DrrB (1)
(-)
Thermotoga maritima [TaxId: 2336] (1)
1P2FA:121-217CRYSTAL STRUCTURE ANALYSIS OF RESPONSE REGULATOR DRRB, A THERMOTOGA MARITIMA OMPR/PHOB HOMOLOG
(-)
Protein domain: Transcriptional regulatory protein PrrA (2)
(-)
Mycobacterium tuberculosis [TaxId: 1773] (2)
1YS6A:128-233; B:128-233CRYSTAL STRUCTURE OF THE RESPONSE REGULATORY PROTEIN PRRA FROM MYCOBACTERIUM TUBERCULOSIS
1YS7A:128-233; B:128-233CRYSTAL STRUCTURE OF THE RESPONSE REGULATOR PROTEIN PRRA COMPLEXED WITH MG2+
(-)
Family: Spo0A (2)
(-)
Protein domain: Spo0A (2)
(-)
Bacillus stearothermophilus [TaxId: 1422] (1)
1FC3A:; B:; C:THE CRYSTAL STRUCTURE OF TRANS-ACTIVATION DOMAIN OF THE SPORULATION RESPONSE REGULATOR, SPO0A
(-)
Bacillus subtilis [TaxId: 1423] (1)
1LQ1A:; B:; C:; D:DNA COMPLEXED STRUCTURE OF THE KEY TRANSCRIPTION FACTOR INITIATING DEVELOPMENT IN SPORULATION BACTERIA
(-)
Superfamily: Homeodomain-like (373)
(-)
Family: Alr1493-like (1)
(-)
Protein domain: Hypothetical protein Ava_0674 (Alr1493 orthologue) (1)
(-)
Anabaena variabilis [TaxId: 1172] (1)
2GA1A:1-102; B:CRYSTAL STRUCTURE OF A DUF433 MEMBER PROTEIN (AVA_0674) FROM ANABAENA VARIABILIS ATCC 29413 AT 2.00 A RESOLUTION
(-)
Family: AraC type transcriptional activator (2)
(-)
Protein domain: MarA (1)
(-)
Escherichia coli [TaxId: 562] (1)
1BL0A:9-62; A:63-124MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN (MARA)/DNA COMPLEX
(-)
Protein domain: Rob transcription factor, N-terminal domain (1)
(-)
Escherichia coli [TaxId: 562] (1)
1D5YA:3-56; A:57-121; B:3-56; B:57-121; C:3-56; C:57-121; D:3-56; D:57-121CRYSTAL STRUCTURE OF THE E. COLI ROB TRANSCRIPTION FACTOR IN COMPLEX WITH DNA
(-)
Family: automated matches (53)
(-)
Protein domain: automated matches (53)
(-)
African clawed frog (Xenopus laevis) [TaxId: 8355] (1)
2NOGB:828-895SANT DOMAIN STRUCTURE OF XENOPUS REMODELING FACTOR ISWI
(-)
Bacillus cereus [TaxId: 1396] (1)
2WV1A:4-76; B:4-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 169-186 SUBSTITUTED BY A LINKER CONTAINING TWO THROMBIN SITES
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3UKGA:360-445CRYSTAL STRUCTURE OF RAP1/DNA COMPLEX
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
3ZOBA:SOLUTION STRUCTURE OF CHICKEN ENGRAILED 2 HOMEODOMAIN
(-)
Escherichia coli [TaxId: 562] (5)
2VKVA:6-67TETR (BD) VARIANT L17G WITH REVERSE PHENOTYPE
2XRLA:2-67TET-REPRESSOR CLASS D T103A WITH DOXYCYCLINE
4AC0A:2-67TETR(B) IN COMPLEX WITH MINOCYCLINE AND MAGNESIUM
4B1RA:2-67TETRACYCLINE REPRESSOR CLASS D MUTANT H100A IN COMPLEX WITH ISO-7-CHLORTETRACYCLINE
4B3AA:2-67TETRACYCLINE REPRESSOR CLASS D MUTANT H100A IN COMPLEX WITH TETRACYCLINE
(-)
Fission yeast (Schizosaccharomyces pombe) [TaxId: 4896] (1)
2ELKA:SOLUTION STRUCTURE OF THE SANT DOMAIN OF FISSION YEAST SPCC24B10.08C PROTEIN
(-)
Golden hamster (Mesocricetus auratus) [TaxId: 10036] (1)
2H1KA:; B:CRYSTAL STRUCTURE OF THE PDX1 HOMEODOMAIN IN COMPLEX WITH DNA
(-)
Human (Homo sapiens) [TaxId: 9606] (19)
2DA1A:SOLUTION STRUCTURE OF THE FIRST HOMEOBOX DOMAIN OF AT-BINDING TRANSCRIPTION FACTOR 1 (ATBF1)
2DA3A:SOLUTION STRUCTURE OF THE THIRD HOMEOBOX DOMAIN OF AT-BINDING TRANSCRIPTION FACTOR 1 (ATBF1)
2DA5A:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF ZINC FINGERS AND HOMEOBOXES PROTEIN 3 (TRIPLE HOMEOBOX 1 PROTEIN)
2DJNA:THE SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN DLX-5
2DMQA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF LIM/HOMEOBOX PROTEIN LHX9
2DMTA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN BARH-LIKE 1
2DMUA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN GOOSECOID
2DN0A:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF HUMAN ZINC FINGERS AND HOMEOBOXES PROTEIN 3
2K40A:NMR STRUCTURE OF HESX-1 HOMEODOMAIN DOUBLE MUTANT R31L/E42L
2L7FP:SOLUTION STRUCTURE OF THE PITX2 HOMEODOMAIN
2L7MP:SOLUTION STRUCTURE OF THE PITX2 HOMEODOMAIN R24H MUTANT
2L7ZA:NMR STRUCTURE OF A13 HOMEDOMAIN
2LTPA:SOLUTION STRUCTURE OF THE SANT2 DOMAIN OF THE HUMAN NUCLEAR RECEPTOR COREPRESSOR 2 (NCOR2), NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET ID HR4636E
2M0CA:SOLUTION NMR STRUCTURE OF HOMEOBOX DOMAIN OF HUMAN ALX4, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4490C
2M34A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS
2ME0A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS SOLVED IN THE PRESENCE OF THE DNA SEQUENCE CGACTAATTAGTCG
2ME6A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS IN COMPLEX WITH THE DNA SEQUENCE CGACTAATTAGTCG
2YUMA:SOLUTION STRUCTURE OF THE MYB-LIKE DNA-BINDING DOMAIN OF HUMAN ZZZ3 PROTEIN
3A03A:CRYSTAL STRUCTURE OF HOX11L1 HOMEODOMAIN
(-)
Mouse (Mus musculus) [TaxId: 10090] (5)
2D9AA:SOLUTION STRUCTURE OF RSGI RUH-050, A MYB DNA-BINDING DOMAIN IN MOUSE CDNA
2DMSA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN OTX2
2LD5A:SOLUTION NMR-DERIVED COMPLEX STRUCTURE OF HOXA13 DNA BINDING DOMAIN BOUND TO DNA
2VI6A:; B:; C:; D:; E:; F:; G:; H:CRYSTAL STRUCTURE OF THE NANOG HOMEODOMAIN
2XSDC:343-397CRYSTAL STRUCTURE OF THE DIMERIC OCT-6 (POU3F1) POU DOMAIN BOUND TO PALINDROMIC MORE DNA
(-)
Mycobacterium tuberculosis [TaxId: 1773] (12)
3G1LA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14744
3G1MA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31381
3G1OA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14500
3O8GA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14801
3O8HA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14950
3Q0UA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31379
3Q0VA:22-92; B:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31369
3Q0WA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM33066
3Q3SA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM5683
3SDGA:26-92ETHIONAMIDE BOOSTERS PART 2: COMBINING BIOISOSTERIC REPLACEMENT AND STRUCTURE-BASED DRUG DESIGN TO SOLVE PHARMACOKINETIC ISSUES IN A SERIES OF POTENT 1,2,4-OXADIAZOLE ETHR INHIBITORS.
3SFIA:22-94ETHIONAMIDE BOOSTERS PART 2: COMBINING BIOISOSTERIC REPLACEMENT AND STRUCTURE-BASED DRUG DESIGN TO SOLVE PHARMACOKINETIC ISSUES IN A SERIES OF POTENT 1,2,4-OXADIAZOLE ETHR INHIBITORS.
4DW6A:24-93NOVEL N-PHENYL-PHENOXYACETAMIDE DERIVATIVES AS POTENTIAL ETHR INHIBITORS AND ETHIONAMIDE BOOSTERS. DISCOVERY AND OPTIMIZATION USING HIGH-THROUGHPUT SYNTHESIS.
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
2D5VA:100-155; B:100-155CRYSTAL STRUCTURE OF HNF-6ALPHA DNA-BINDING DOMAIN IN COMPLEX WITH THE TTR PROMOTER
(-)
Pasteurella multocida [TaxId: 747] (1)
2VPRA:2-67TET REPRESSOR CLASS H IN COMPLEX WITH 5A,6-ANHYDROTETRACYCLINE-MG
(-)
Trichomonas vaginalis [TaxId: 5722] (4)
2K9NA:1-49; A:50-107SOLUTION NMR STRUCTURE OF THE R2R3 DNA BINDING DOMAIN OF MYB1 PROTEIN FROM PROTOZOAN PARASITE TRICHOMONAS VAGINALIS
2KDZA:1-49; A:50-107STRUCTURE OF THE R2R3 DNA BINDING DOMAIN OF MYB1 PROTEIN FROM PROTOZOAN PARASITE TRICHOMONAS VAGINALIS IN COMPLEX WITH MRE-1/MRE-2R DNA
3OSFA:48-96; A:97-150; D:48-96; D:97-150THE STRUCTURE OF PROTOZOAN PARASITE TRICHOMONAS VAGINALIS MYB2 IN COMPLEX WITH MRE-2F-13 DNA
3OSGA:40-96; A:97-150; D:48-96; D:97-150THE STRUCTURE OF PROTOZOAN PARASITE TRICHOMONAS VAGINALIS MYB2 IN COMPLEX WITH MRE-1-12 DNA
(-)
Family: Centromere-binding (3)
(-)
Protein domain: Ars-binding protein 1, ABP1 (1)
(-)
Fission yeast (Schizosaccharomyces pombe) [TaxId: 4896] (1)
1IUFA:-2-75; A:76-141LOW RESOLUTION SOLUTION STRUCTURE OF THE TWO DNA-BINDING DOMAINS IN SCHIZOSACCHAROMYCES POMBE ABP1 PROTEIN
(-)
Protein domain: DNA-binding domain of centromere binding protein B (CENP-B) (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1BW6A:HUMAN CENTROMERE PROTEIN B (CENP-B) DNA BINDIGN DOMAIN RP1
1HLVA:1-66; A:67-131CRYSTAL STRUCTURE OF CENP-B(1-129) COMPLEXED WITH THE CENP-B BOX DNA
(-)
Family: Cgl2762-like (1)
(-)
Protein domain: Uncharacterized protein Cgl2762 (1)
(-)
Corynebacterium glutamicum [TaxId: 1718] (1)
2JN6A:1-89SOLUTION NMR STRUCTURE OF PROTEIN CGL2762 FROM CORYNEBACTERIUM GLUTAMICUM: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET CGR3
(-)
Family: DNA-binding domain of rap1 (2)
(-)
Protein domain: automated matches (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3UKGA:446-601CRYSTAL STRUCTURE OF RAP1/DNA COMPLEX
(-)
Protein domain: DNA-binding domain of rap1 (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (1)
1IGNA:360-445; A:446-594; B:360-445; B:446-594DNA-BINDING DOMAIN OF RAP1 IN COMPLEX WITH TELOMERIC DNA SITE
(-)
Family: DNA-binding domain of telomeric protein (9)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
3SJMA:; B:CRYSTAL STRUCTURE ANALYSIS OF TRF2-DBD-DNA COMPLEX
(-)
Protein domain: DNA-binding domain of human telomeric protein, hTRF1 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1BA5A:DNA-BINDING DOMAIN OF HUMAN TELOMERIC PROTEIN, HTRF1, NMR, 18 STRUCTURES
1ITYA:SOLUTION STRUCTURE OF THE DNA BINDING DOMAIN OF HUMAN TRF1
1IV6A:SOLUTION STRUCTURE OF THE DNA COMPLEX OF HUMAN TRF1
1W0TA:; B:HTRF1 DNA-BINDING DOMAIN IN COMPLEX WITH TELOMERIC DNA.
(-)
Protein domain: Telomeric repeat binding factor 2, TRF2 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1VF9A:SOLUTION STRUCTURE OF HUMAN TRF2
1VFCA:438-500SOLUTION STRUCTURE OF THE DNA COMPLEX OF HUMAN TRF2
1W0UA:; B:HTRF2 DNA-BINDING DOMAIN IN COMPLEX WITH TELOMERIC DNA.
1XG1A:5-67SOLUTION STRUCTURE OF MYB-DOMAIN OF HUMAN TRF2
(-)
Family: FIS-like (34)
(-)
Protein domain: DNA-binding domain of NTRC (1)
(-)
Salmonella typhimurium [TaxId: 90371] (1)
1NTCA:; B:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF NTRC WITH THREE ALANINE SUBSTITUTIONS
(-)
Protein domain: FIS protein (31)
(-)
Escherichia coli K-12 [TaxId: 83333] (15)
3IV5A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F1
3JR9A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F2
3JRAA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP NON CONSENSUS SEQUENCE DNA F6
3JRBA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F24 CONTAINING T-TRACT AT CENTER
3JRCA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F29 CONTAINING 5 G/CS AT CENTER
3JRDA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F25 CONTAINING T2A3 SEQUENCE AT CENTER
3JREA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F26 CONTAINING A-TRACT AT CENTER
3JRFA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F27 CONTAINING A C/G AT CENTER
3JRGA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F18
3JRHA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F21
3JRIA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F23
4IHVB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
4IHWB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
4IHXB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
4IHYB:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)
(-)
Escherichia coli [TaxId: 562] (16)
1ETKA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q68A
1ETOA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71L
1ETQA:; B:; C:; D:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71Y
1ETVA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72A
1ETWA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72D
1ETXA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q74A
1ETYA:; B:THE CRYSTAL STRUCTURE OF E. COLI WILD-TYPE FIS
1F36A:; B:THE CRYSTAL STRUCTURE OF FIS MUTANT K36E REVEALS THAT THE TRANSACTIVATION REGION OF THE FIS PROTEIN CONTAINS EXTENDED MOBILE BETA-HAIRPIN ARMS
1FIAA:; B:CRYSTAL STRUCTURE OF THE FACTOR FOR INVERSION STIMULATION FIS AT 2.0 ANGSTROMS RESOLUTION
1FIPA:; B:THE STRUCTURE OF FIS MUTANT PRO61ALA ILLUSTRATES THAT THE KINK WITHIN THE LONG ALPHA-HELIX IS NOT DUE TO THE PRESENCE OF THE PROLINE RESIDUE
3FISA:; B:THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING
4FISA:; B:THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING
4IHVA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
4IHWA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
4IHXA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
4IHYA:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)
(-)
Protein domain: Photosynthetic apparatus regulatory protein PprA (RegA), DNA-binding domain (1)
(-)
Rhodobacter sphaeroides [TaxId: 1063] (1)
1UMQA:SOLUTION STRUCTURE AND DNA BINDING OF THE EFFECTOR DOMAIN FROM THE GLOBAL REGULATOR PRRA(REGA) FROM R. SPHAEROIDES: INSIGHTS INTO DNA BINDING SPECIFICITY
(-)
Protein domain: Transcriptional regulator TyrR, C-terminal domain (1)
(-)
Haemophilus influenzae [TaxId: 727] (1)
1G2HA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF THE TYRR PROTEIN OF HAEMOPHILUS INFLUENZAE
(-)
Family: GARP response regulators (1)
(-)
Protein domain: Arr10-B (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1IRZA:SOLUTION STRUCTURE OF ARR10-B BELONGING TO THE GARP FAMILY OF PLANT MYB-RELATED DNA BINDING MOTIFS OF THE ARABIDOPSIS RESPONSE REGULATORS
(-)
Family: Homeodomain (93)
(-)
Protein domain: Antennapedia Homeodomain (5)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (5)
1AHDP:DETERMINATION OF THE NMR SOLUTION STRUCTURE OF AN ANTENNAPEDIA HOMEODOMAIN-DNA COMPLEX
1HOMA:DETERMINATION OF THE THREE-DIMENSIONAL STRUCTURE OF THE ANTENNAPEDIA HOMEODOMAIN FROM DROSOPHILA IN SOLUTION BY 1H NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY
1SANA:THE DES(1-6)ANTENNAPEDIA HOMEODOMAIN: COMPARISON OF THE NMR SOLUTION STRUCTURE AND THE DNA BINDING AFFINITY WITH THE INTACT ANTENNAPEDIA HOMEODOMAIN
2HOAA:STRUCTURE DETERMINATION OF THE ANTP(C39->S) HOMEODOMAIN FROM NUCLEAR MAGNETIC RESONANCE DATA IN SOLUTION USING A NOVEL STRATEGY FOR THE STRUCTURE CALCULATION WITH THE PROGRAMS DIANA, CALIBA, HABAS AND GLOMSA
9ANTA:; B:ANTENNAPEDIA HOMEODOMAIN-DNA COMPLEX
(-)
Protein domain: automated matches (13)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (5)
2R5YA:; B:STRUCTURE OF SCR/EXD COMPLEX BOUND TO A CONSENSUS HOX-EXD SITE
2R5ZA:; B:STRUCTURE OF SCR/EXD COMPLEX BOUND TO A DNA SEQUENCE DERIVED FROM THE FKH GENE
3A01A:; B:; E:; F:CRYSTAL STRUCTURE OF ARISTALESS AND CLAWLESS HOMEODOMAINS BOUND TO DNA
3A02A:CRYSTAL STRUCTURE OF ARISTALESS HOMEODOMAIN
3LNQA:STRUCTURE OF ARISTALESS HOMEODOMAIN IN COMPLEX WITH DNA
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
2DA6A:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HEPATOCYTE NUCLEAR FACTOR 1-BETA (HNF-1BETA)
2LMDA:MINIMAL CONSTRAINTS SOLUTION NMR STRUCTURE OF PROSPERO HOMEOBOX PROTEIN 1 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET HR4660B
2LP0A:THE SOLUTION STRUCTURE OF HOMEODOMAIN-PROTEIN COMPLEX
3CMYA:STRUCTURE OF A HOMEODOMAIN IN COMPLEX WITH DNA
3K2AA:; B:CRYSTAL STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN MEIS2
3RKQA:; B:NKX2.5 HOMEODOMAIN DIMER BOUND TO ANF-242 DNA
4J19A:; B:STRUCTURE OF A NOVEL TELOMERE REPEAT BINDING PROTEIN BOUND TO DNA
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2HI3A:SOLUTION STRUCTURE OF THE HOMEODOMAIN-ONLY PROTEIN HOP
(-)
Protein domain: DNA-binding protein SATB2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1WI3A:SOLUTION STRUCTURE OF THE HOMEODOMAIN OF KIAA1034 PROTEIN
(-)
Protein domain: Engrailed Homeodomain (12)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (12)
1DU0A:; B:ENGRAILED HOMEODOMAIN Q50A VARIANT DNA COMPLEX
1ENHA:STRUCTURAL STUDIES OF THE ENGRAILED HOMEODOMAIN
1HDDC:; D:CRYSTAL STRUCTURE OF AN ENGRAILED HOMEODOMAIN-DNA COMPLEX AT 2.8 ANGSTROMS RESOLUTION: A FRAMEWORK FOR UNDERSTANDING HOMEODOMAIN-DNA INTERACTIONS
1P7IA:; B:; C:; D:CRYSTAL STRUCTURE OF ENGRAILED HOMEODOMAIN MUTANT K52A
1P7JA:; C:; D:; B:CRYSTAL STRUCTURE OF ENGRAILED HOMEODOMAIN MUTANT K52E
1ZTRA:0-59SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN L16A MUTANT
2HDDA:; B:ENGRAILED HOMEODOMAIN Q50K VARIANT DNA COMPLEX
2HOSA:; B:PHAGE-SELECTED HOMEODOMAIN BOUND TO UNMODIFIED DNA
2HOTA:; B:PHAGE SELECTED HOMEODOMAIN BOUND TO MODIFIED DNA
2JWTA:SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN WT
2P81A:ENGRAILED HOMEODOMAIN HELIX-TURN-HELIX MOTIF
3HDDA:; B:ENGRAILED HOMEODOMAIN DNA COMPLEX
(-)
Protein domain: Even-skipped homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1JGGA:; B:EVEN-SKIPPED HOMEODOMAIN COMPLEXED TO AT-RICH DNA
(-)
Protein domain: Extradenticle (exd) homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1B8IB:STRUCTURE OF THE HOMEOTIC UBX/EXD/DNA TERNARY COMPLEX
(-)
Protein domain: Fushi Tarazu protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1FTZA:NUCLEAR MAGNETIC RESONANCE SOLUTION STRUCTURE OF THE FUSHI TARAZU HOMEODOMAIN FROM DROSOPHILA AND COMPARISON WITH THE ANTENNAPEDIA HOMEODOMAIN
(-)
Protein domain: Hepatocyte nuclear factor 1a (LFB1/HNF1) (3)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1IC8A:201-276; B:201-278HEPATOCYTE NUCLEAR FACTOR 1A BOUND TO DNA : MODY3 GENE PRODUCT
(-)
Rat (Rattus rattus) [TaxId: 10117] (2)
1LFBA:THE X-RAY STRUCTURE OF AN ATYPICAL HOMEODOMAIN PRESENT IN THE RAT LIVER TRANSCRIPTION FACTOR LFB1(SLASH)HNF1 AND IMPLICATIONS FOR DNA BINDING
2LFBA:HOMEODOMAIN FROM RAT LIVER LFB1/HNF1 TRANSCRIPTION FACTOR, NMR, 20 STRUCTURES
(-)
Protein domain: Hepatocyte nuclear factor 6 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1S7EA:103-152SOLUTION STRUCTURE OF HNF-6
(-)
Protein domain: Homeo-prospero domain of Prospero protein (2)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (2)
1MIJA:CRYSTAL STRUCTURE OF THE HOMEO-PROSPERO DOMAIN OF D. MELANOGASTER PROSPERO
1XPXA:STRUCTURAL BASIS OF PROSPERO-DNA INTERACTION; IMPLICATIONS FOR TRANSCRIPTION REGULATION IN DEVELOPING CELLS
(-)
Protein domain: Homeobox protein hox-a9 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1PUFA:CRYSTAL STRUCTURE OF HOXA9 AND PBX1 HOMEODOMAINS BOUND TO DNA
(-)
Protein domain: Homeobox protein hox-b1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1B72A:PBX1, HOMEOBOX PROTEIN HOX-B1/DNA TERNARY COMPLEX
(-)
Protein domain: Homeobox protein hox-b13 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CRAA:7-64SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEO BOX B13
(-)
Protein domain: Homeobox protein pknox1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1X2NA:6-67SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN PKNOX1
(-)
Protein domain: Homeobox protein prh (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2E1OA:8-64SOLUTION STRUCTURE OF RSGI RUH-028, A HOMEOBOX DOMAIN FROM HUMAN CDNA
(-)
Protein domain: Homeobox-containing protein 1, HMBOX1 (Flj21616) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CUFA:8-89SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF THE HUMAN HYPOTHETICAL PROTEIN FLJ21616
(-)
Protein domain: Homeobox-leucine zipper protein Homez (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2ECCA:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF HUMAN HOMEODOMAIN LEUCINE ZIPPER-ENCODING GENE (HOMEZ)
(-)
Protein domain: Homeodomain-only protein, Hop (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1UHSA:SOLUTION STRUCTURE OF MOUSE HOMEODOMAIN-ONLY PROTEIN HOP
(-)
Protein domain: Homeotic bicoid protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1ZQ3P:2-68NMR SOLUTION STRUCTURE OF THE BICOID HOMEODOMAIN BOUND TO THE CONSENSUS DNA BINDING SITE TAATCC
(-)
Protein domain: Hypothetical protein 4930532d21rik (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1X58A:8-56SOLUTION STRUCTURES OF THE MYB-LIKE DNA BINDING DOMAIN OF 4930532D21RIK PROTEIN
(-)
Protein domain: Insulin gene enhancer protein isl-1 (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1BW5A:THE NMR SOLUTION STRUCTURE OF THE HOMEODOMAIN OF THE RAT INSULIN GENE ENHANCER PROTEIN ISL-1, 50 STRUCTURES
(-)
Protein domain: LAG1 longevity assurance homolog 5, LASS5 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2CQXA:8-66SOLUTION STRUCTURE OF RSGI RUH-034, A HOMEODOMAIN FROM MOUSE CDNA
(-)
Protein domain: Lag1 longevity assurance homolog 6, LASS6 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1X2MA:8-59SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF MOUSE LAG1 LONGEVITY ASSURANCE HOMOLOG 6
(-)
Protein domain: mat alpha2 Homeodomain (6)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (6)
1AKHB:MAT A1/ALPHA2/DNA TERNARY COMPLEX
1APLC:; D:CRYSTAL STRUCTURE OF A MAT-ALPHA2 HOMEODOMAIN-OPERATOR COMPLEX SUGGESTS A GENERAL MODEL FOR HOMEODOMAIN-DNA INTERACTIONS
1K61A:; B:; C:; D:MATALPHA2 HOMEODOMAIN BOUND TO DNA
1LE8B:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2-3A HETERODIMER BOUND TO DNA COMPLEX
1MNMC:; D:YEAST MATALPHA2/MCM1/DNA TERNARY TRANSCRIPTION COMPLEX CRYSTAL STRUCTURE
1YRNB:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2 HOMEODOMAIN HETERODIMER BOUND TO DNA
(-)
Protein domain: Mating type protein A1 Homeodomain (6)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (6)
1AKHA:MAT A1/ALPHA2/DNA TERNARY COMPLEX
1F43A:SOLUTION STRUCTURE OF THE MATA1 HOMEODOMAIN
1LE8A:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2-3A HETERODIMER BOUND TO DNA COMPLEX
1MH3A:472-526MALTOSE BINDING-A1 HOMEODOMAIN PROTEIN CHIMERA, CRYSTAL FORM I
1MH4A:472-523MALTOSE BINDING-A1 HOMEODOMAIN PROTEIN CHIMERA, CRYSTAL FORM II
1YRNA:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2 HOMEODOMAIN HETERODIMER BOUND TO DNA
(-)
Protein domain: Msx-1 homeodomain (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1IG7A:MSX-1 HOMEODOMAIN/DNA COMPLEX STRUCTURE
(-)
Protein domain: Oct-1 POU Homeodomain (7)
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
1CQTA:102-161; B:602-661CRYSTAL STRUCTURE OF A TERNARY COMPLEX CONTAINING AN OCA-B PEPTIDE, THE OCT-1 POU DOMAIN, AND AN OCTAMER ELEMENT
1E3OC:104-160CRYSTAL STRUCTURE OF OCT-1 POU DIMER BOUND TO MORE
1GT0C:97-159CRYSTAL STRUCTURE OF A POU/HMG/DNA TERNARY COMPLEX
1HF0A:102-159; B:102-159CRYSTAL STRUCTURE OF THE DNA-BINDING DOMAIN OF OCT-1 BOUND TO DNA AS A DIMER
1O4XA:110-163TERNARY COMPLEX OF THE DNA BINDING DOMAINS OF THE OCT1 AND SOX2 TRANSCRIPTION FACTORS WITH A 19MER OLIGONUCLEOTIDE FROM THE HOXB1 REGULATORY ELEMENT
1OCTC:102-161CRYSTAL STRUCTURE OF THE OCT-1 POU DOMAIN BOUND TO AN OCTAMER SITE: DNA RECOGNITION WITH TETHERED DNA-BINDING MODULES
1POGA:SOLUTION STRUCTURE OF THE OCT-1 POU-HOMEO DOMAIN DETERMINED BY NMR AND RESTRAINED MOLECULAR DYNAMICS
(-)
Protein domain: Oct-2 POU Homeodomain (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1HDPA:SOLUTION STRUCTURE OF A POU-SPECIFIC HOMEODOMAIN: 3D-NMR STUDIES OF HUMAN B-CELL TRANSCRIPTION FACTOR OCT-2
(-)
Protein domain: Oct-3 POU Homeodomain (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1OCPA:SOLUTION STRUCTURE OF OCT3 POU-HOMEODOMAIN
(-)
Protein domain: Paired box protein pax6 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CUEA:7-74SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF THE HUMAN PAIRED BOX PROTEIN PAX-6
(-)
Protein domain: Paired protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1FJLA:; B:; C:HOMEODOMAIN FROM THE DROSOPHILA PAIRED PROTEIN BOUND TO A DNA OLIGONUCLEOTIDE
(-)
Protein domain: pbx1 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1B72B:PBX1, HOMEOBOX PROTEIN HOX-B1/DNA TERNARY COMPLEX
1PUFB:CRYSTAL STRUCTURE OF HOXA9 AND PBX1 HOMEODOMAINS BOUND TO DNA
(-)
Mouse (Mus musculus) [TaxId: 10090] (2)
1DU6A:SOLUTION STRUCTURE OF THE TRUNCATED PBX HOMEODOMAIN
1LFUP:NMR SOLUTION STRUCTURE OF THE EXTENDED PBX HOMEODOMAIN BOUND TO DNA
(-)
Protein domain: Pit-1 POU homeodomain (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1AU7A:103-160; B:103-160PIT-1 MUTANT/DNA COMPLEX
(-)
Protein domain: Pituitary homeobox 2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2LKXA:1-60NMR STRUCTURE OF THE HOMEODOMAIN OF PITX2 IN COMPLEX WITH A TAATCC DNA BINDING SITE
(-)
Protein domain: Thyroid transcription factor 1 homeodomain (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1FTTA:THYROID TRANSCRIPTION FACTOR 1 HOMEODOMAIN (RATTUS NORVEGICUS)
(-)
Protein domain: Transcriptional adaptor 2-like, TADA2L, isoform b (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1X41A:8-54SOLUTION STRUCTURE OF THE MYB-LIKE DNA BINDING DOMAIN OF HUMAN TRANSCRIPTIONAL ADAPTOR 2-LIKE, ISOFORM B
(-)
Protein domain: Ultrabithorax (ubx) homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1B8IA:STRUCTURE OF THE HOMEOTIC UBX/EXD/DNA TERNARY COMPLEX
(-)
Protein domain: VND/NK-2 protein (4)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (4)
1NK2P:VND/NK-2 HOMEODOMAIN/DNA COMPLEX, NMR, 20 STRUCTURES
1NK3P:VND/NK-2 HOMEODOMAIN/DNA COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE
1QRYA:HOMEOBOX PROTEIN VND (VENTRAL NERVOUS SYSTEM DEFECTIVE PROTEIN)
1VNDA:VND/NK-2 PROTEIN (HOMEODOMAIN), NMR
(-)
Protein domain: ZF-HD homeobox protein At4g24660 (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1WH7A:SOLUTION STRUCTURE OF HOMEOBOX DOMAIN OF ARABIDOPSIS THALIANA HYPOTHETICAL PROTEIN F22K18.140
(-)
Protein domain: ZF-HD homeobox protein At5g65410 (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1WH5A:SOLUTION STRUCTURE OF HOMEOBOX DOMAIN OF ARABIDOPSISTHALIANA ZINC FINGER HOMEOBOX FAMILY PROTEIN
(-)
Protein domain: Zinc fingers and homeoboxes protein 1, ZHX1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2ECBA:8-83THE SOLUTION STRUCTURE OF THE THIRD HOMEOBOX DOMAIN OF HUMAN ZINC FINGERS AND HOMEOBOXES PROTEIN
(-)
Family: Middle operon regulator, Mor (1)
(-)
Protein domain: Middle operon regulator, Mor (1)
(-)
Bacteriophage Mu [TaxId: 10677] (1)
1RR7A:CRYSTAL STRUCTURE OF THE MIDDLE OPERON REGULATOR PROTEIN OF BACTERIOPHAGE MU
(-)
Family: Myb/SANT domain (34)
(-)
Protein domain: 2610100b20rik gene product (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1UG2A:SOLUTION STRUCTURE OF MOUSE HYPOTHETICAL GENE (2610100B20RIK) PRODUCT HOMOLOGOUS TO MYB DNA-BINDING DOMAIN
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
4A69C:; D:STRUCTURE OF HDAC3 BOUND TO COREPRESSOR AND INOSITOL TETRAPHOSPHATE
(-)
Protein domain: b-Myb DNA binding domain (1)
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
1A5JA:1-55; A:56-110CHICKEN B-MYB DNA BINDING DOMAIN, REPEAT 2 AND REPEAT3, NMR, 32 STRUCTURES
(-)
Protein domain: c-Myb, DNA-binding domain (16)
(-)
Mouse (Mus musculus) [TaxId: 10090] (16)
1GUUA:CRYSTAL STRUCTURE OF C-MYB R1
1GV2A:89-143; A:144-190CRYSTAL STRUCTURE OF C-MYB R2R3
1GV5A:CRYSTAL STRUCTURE OF C-MYB R2
1GVDA:CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT
1H88C:39-88; C:89-143; C:144-190CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1
1H89C:77-88; C:89-143; C:144-191CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2
1IDYA:STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE
1IDZA:STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES
1MBEA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1
1MBFA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1
1MBGA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 2
1MBHA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 2
1MBJA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 3
1MBKA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 3
1MSEC:89-143; C:144-193SOLUTION STRUCTURE OF A SPECIFIC DNA COMPLEX OF THE MYB DNA-BINDING DOMAIN WITH COOPERATIVE RECOGNITION HELICES
1MSFC:89-143; C:144-193SOLUTION STRUCTURE OF A SPECIFIC DNA COMPLEX OF THE MYB DNA-BINDING DOMAIN WITH COOPERATIVE RECOGNITION HELICES
(-)
Protein domain: DnaJ homolog subfamily C member 1 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
2CQQA:8-66SOLUTION STRUCTURE OF RSGI RUH-037, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
2CQRA:7-66SOLUTION STRUCTURE OF RSGI RUH-043, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
(-)
Protein domain: Hypothetical protein C14orf106 (KIAA1903) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1WGXA:SOLUTION STRUCTURE OF RSGI RUH-022, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
(-)
Protein domain: Metastasis associated protein MTA3 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2CRGA:8-64SOLUTION STRUCTURE OF THE MYB-LIKE DNA-BINDING DOMAIN OF MOUSE MTA3 PROTEIN
(-)
Protein domain: MYSM1 (KIAA1915) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CU7A:8-72SOLUTION STRUCTURE OF THE SANT DOMAIN OF HUMAN KIAA1915 PROTEIN
(-)
Protein domain: Nuclear receptor corepressor 2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1XC5A:413-480SOLUTION STRUCTURE OF THE SMRT DEACETYLASE ACTIVATION DOMAIN
(-)
Protein domain: Radialis (1)
(-)
Garden snapdragon (Antirrhinum majus) [TaxId: 4151] (1)
2CJJA:8-70CRYSTAL STRUCTURE OF THE MYB DOMAIN OF THE RAD TRANSCRIPTION FACTOR FROM ANTIRRHINUM MAJUS
(-)
Protein domain: Rap1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1FEXA:SOLUTION STRUCTURE OF MYB-DOMAIN OF HUMAN RAP1
(-)
Protein domain: REST corepressor 1, CoREST (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
2IW5B:376-440STRUCTURAL BASIS FOR COREST-DEPENDENT DEMETHYLATION OF NUCLEOSOMES BY THE HUMAN LSD1 HISTONE DEMETHYLASE
2UXNB:376-440STRUCTURAL BASIS OF HISTONE DEMETHYLATION BY LSD1 REVEALED BY SUICIDE INACTIVATION
(-)
Protein domain: SANT domain of the nucleosome remodeling ATPase ISWI (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1OFCX:799-850NUCLEOSOME RECOGNITION MODULE OF ISWI ATPASE
(-)
Protein domain: Telomere binding protein TBP1 (2)
(-)
Tobacco (Nicotiana tabacum) [TaxId: 4097] (2)
2CKXA:578-660CRYSTAL STRUCTURE OF NGTRF1, DOUBLE-STRANDED TELOMERIC REPEAT BINDING FACTOR FROM NICOTIANA TABACUM.
2QHBA:; B:CRYSTAL STRUCTURE OF NGTRF COMPLEXED WITH TELOMERIC DNA
(-)
Protein domain: Telomere repeat-binding protein (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
2AJEA:9-105SOLUTION STRUCTURE OF THE ARABIDOPSIS THALIANA TELOMERIC REPEAT-BINDING PROTEIN DNA BINDING DOMAIN
(-)
Protein domain: v-Myb (1)
(-)
Avian myeloblastosis virus [TaxId: 11866] (1)
1H8AC:87-143; C:144-191CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX3
(-)
Family: Nanomeric phage protein-like (1)
(-)
Protein domain: Phage protein BC1890 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2AO9A:13-132; B:; C:; D:; E:; F:; G:; H:; I:STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PHAGE PROTEIN (PHBC6A51) FROM BACILLUS CEREUS ATCC 14579
(-)
Family: Paired domain (4)
(-)
Protein domain: Paired protein (prd) (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1PDNC:2-66; C:67-124CRYSTAL STRUCTURE OF A PAIRED DOMAIN-DNA COMPLEX AT 2.5 ANGSTROMS RESOLUTION REVEALS STRUCTURAL BASIS FOR PAX DEVELOPMENTAL MUTATIONS
(-)
Protein domain: Pax-5 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1K78A:19-81; A:82-142; E:19-81; E:82-142; I:84-141PAX5(1-149)+ETS-1(331-440)+DNA
1MDMA:19-81; A:82-142INHIBITED FRAGMENT OF ETS-1 AND PAIRED DOMAIN OF PAX5 BOUND TO DNA
(-)
Protein domain: Pax-6 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
6PAXA:1-68; A:69-133CRYSTAL STRUCTURE OF THE HUMAN PAX-6 PAIRED DOMAIN-DNA COMPLEX REVEALS A GENERAL MODEL FOR PAX PROTEIN-DNA INTERACTIONS
(-)
Family: Psq domain (1)
(-)
Protein domain: Ligand-dependent corepressor (LCoR) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2COBA:8-70SOLUTION STRUCTURES OF THE HTH DOMAIN OF HUMAN LCOR PROTEIN
(-)
Family: Recombinase DNA-binding domain (20)
(-)
Protein domain: gamma,delta resolvase (C-terminal domain) (6)
(-)
Escherichia coli [TaxId: 562] (6)
1GDTA:141-183; B:141-183CRYSTAL STRUCTURE OF A SITE-SPECIFIC RECOMBINASE, GAMMA-DELTA RESOLVASE COMPLEXED WITH A 34 BP CLEAVAGE SITE
1RESA:DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION
1RETA:DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION
1ZR2A:141-183; B:141-183STRUCTURE OF A SYNAPTIC GAMMA-DELTA RESOLVASE TETRAMER COVALENTLY LINKED TO TWO CLEAVED DNAS
1ZR4A:141-183; B:141-183; D:141-183; E:141-183STRUCTURE OF A SYNAPTIC GAMMA-DELTA RESOLVASE TETRAMER COVALENTLY LINKED TO TWO CLEAVED DNAS
2GM4A:141-183; B:141-183AN ACTIVATED, TETRAMERIC GAMMA-DELTA RESOLVASE: HIN CHIMAERA BOUND TO CLEAVED DNA
(-)
Protein domain: HIN recombinase (DNA-binding domain) (8)
(-)
Synthetic (8)
1HCRA:HIN RECOMBINASE BOUND TO DNA: THE ORIGIN OF SPECIFICITY IN MAJOR AND MINOR GROOVE INTERACTIONS
1IJWC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS.
1JJ6C:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS.
1JJ8C:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKOC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKPC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKQC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKRC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
(-)
Protein domain: Ibeta subdomain of the mu end DNA-binding domain of phage mu transposase (2)
(-)
Bacteriophage Mu [TaxId: 10677] (2)
2EZKA:SOLUTION NMR STRUCTURE OF THE IBETA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF PHAGE MU TRANSPOSASE, REGULARIZED MEAN STRUCTURE
2EZLA:SOLUTION NMR STRUCTURE OF THE IBETA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF PHAGE MU TRANSPOSASE, 29 STRUCTURES
(-)
Protein domain: Transposase (2)
(-)
Bacteriophage Mu [TaxId: 10677] (2)
2EZHA:SOLUTION NMR STRUCTURE OF THE IGAMMA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF MU PHAGE TRANSPOSASE, MINIMIZED AVERAGE STRUCTURE
2EZIA:SOLUTION NMR STRUCTURE OF THE IGAMMA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF MU PHAGE TRANSPOSASE, 30 STRUCTURES
(-)
Protein domain: Transposase tc3a1-65 (2)
(-)
Nematode (Caenorhabditis elegans) [TaxId: 6239] (2)
1TC3C:TRANSPOSASE TC3A1-65 FROM CAENORHABDITIS ELEGANS
1U78A:2-54; A:55-104STRUCTURE OF THE BIPARTITE DNA-BINDING DOMAIN OF TC3 TRANSPOSASE BOUND TO TRANSPOSON DNA
(-)
Family: RpiR-like (1)
(-)
Protein domain: Putative transcriptional regulator YbbH (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2O3FA:1-83; B:; C:STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF THE N-TERMINAL DOMAIN OF THE PUTATIVE TRANSCRIPTIONAL REGULATOR YBBH FROM BACILLUS SUBTILIS SUBSP. SUBTILIS STR. 168.
(-)
Family: SLIDE domain (1)
(-)
Protein domain: SLIDE domain of the nucleosome remodeling ATPase ISWI (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1OFCX:851-978NUCLEOSOME RECOGNITION MODULE OF ISWI ATPASE
(-)
Family: SWIRM domain (14)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2L3DA:THE SOLUTION STRUCTURE OF THE SHORT FORM SWIRM DOMAIN OF LSD1
(-)
Protein domain: Lysine-specific histone demethylase 1, LSD1 (9)
(-)
Human (Homo sapiens) [TaxId: 9606] (9)
2COMA:8-118THE SOLUTION STRUCTURE OF THE SWIRM DOMAIN OF HUMAN LSD1
2DW4A:172-273CRYSTAL STRUCTURE OF HUMAN LSD1 AT 2.3 A RESOLUTION
2EJRA:172-273LSD1-TRANYLCYPROMINE COMPLEX
2H94A:172-273CRYSTAL STRUCTURE AND MECHANISM OF HUMAN LYSINE-SPECIFIC DEMETHYLASE-1
2IW5A:171-273STRUCTURAL BASIS FOR COREST-DEPENDENT DEMETHYLATION OF NUCLEOSOMES BY THE HUMAN LSD1 HISTONE DEMETHYLASE
2UXNA:173-273STRUCTURAL BASIS OF HISTONE DEMETHYLATION BY LSD1 REVEALED BY SUICIDE INACTIVATION
2UXXA:171-273HUMAN LSD1 HISTONE DEMETHYLASE-COREST IN COMPLEX WITH AN FAD-TRANYLCYPROMINE ADDUCT
2Z3YA:172-273CRYSTAL STRUCTURE OF LYSINE-SPECIFIC DEMETHYLASE1
2Z5UA:172-273CRYSTAL STRUCTURE OF LYSINE-SPECIFIC HISTONE DEMETHYLASE 1
(-)
Protein domain: Transcription regulatory protein swi3 (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (1)
2FQ3A:311-395STRUCTURE AND FUNCTION OF THE SWIRM DOMAIN, A CONSERVED PROTEIN MODULE FOUND IN CHROMATIN REGULATORY COMPLEXES
(-)
Protein domain: Transcriptional adaptor 2-like, TADA2L (3)
(-)
Mouse (Mus musculus) [TaxId: 10090] (3)
2AQEA:2-90STRUCTURAL AND FUNCTIONAL ANALYSIS OF ADA2 ALPHA SWIRM DOMAIN
2AQFA:STRUCTURAL AND FUNCTIONAL ANALYSIS OF ADA2 ALPHA SWIRM DOMAIN
2CUJA:8-108SOLUTION STRUCTURE OF SWIRM DOMAIN OF MOUSE TRANSCRIPTIONAL ADAPTOR 2-LIKE
(-)
Family: Tetracyclin repressor-like, N-terminal domain (97)
(-)
Protein domain: A-factor receptor homolog CprB (2)
(-)
Streptomyces coelicolor [TaxId: 1902] (2)
1UI5A:5-75; B:5-75CRYSTAL STRUCTURE OF GAMMA-BUTYROLACTONE RECEPTOR (ARPA LIKE PROTEIN)
1UI6A:5-75; B:6-75CRYSTAL STRUCTURE OF GAMMA-BUTYROLACTONE RECEPTOR (ARPA-LIKE PROTEIN)
(-)
Protein domain: automated matches (2)
(-)
Bacillus cereus [TaxId: 1396] (2)
2JJ7A:3-76; B:1-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 170-185 SUBSTITUTED BY ALANINE
2JK3A:4-76; B:4-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 169-186 SUBSTITUTED BY GSSGSSG LINKER
(-)
Protein domain: Ethr repressor (5)
(-)
Mycobacterium tuberculosis [TaxId: 1773] (5)
1T56A:22-94CRYSTAL STRUCTURE OF TETR FAMILY REPRESSOR M. TUBERCULOSIS ETHR
1U9NA:22-94CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR ETHR IN A LIGAND BOUND CONFORMATION OPENS THERAPEUTIC PERSPECTIVES AGAINST TUBERCULOSIS AND LEPROSY
1U9OA:22-94CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR ETHR IN A LIGAND BOUND CONFORMATION
3TP0A:24-93STRUCTURAL ACTIVATION OF THE TRANSCRIPTIONAL REPRESSOR ETHR FROM M. TUBERCULOSIS BY SINGLE AMINO-ACID CHANGE MIMICKING NATURAL AND SYNTHETIC LIGANDS
3TP3A:22-94STRUCTURE OF HTH-TYPE TRANSCRIPTIONAL REGULATOR ETHR, G106W MUTANT
(-)
Protein domain: Hemolysin II regulatory protein, HlyIIR (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2FX0A:4-76CRYSTAL STRUCTURE OF HLYIIR, A HEMOLYSIN II TRANSCRIPTIONAL REGULATOR
(-)
Protein domain: Hypothetical transcriptional regulator YcdC (2)
(-)
Escherichia coli [TaxId: 562] (2)
3LOCA:11-85; B:11-85; C:12-85; D:11-85CRYSTAL STRUCTURE OF PUTATIVE TRANSCRIPTIONAL REGULATOR YCDC
4JYKA:12-86; B:17-86STRUCTURE OF E. COLI TRANSCRIPTIONAL REGULATOR RUTR WITH BOUND URACIL
(-)
Protein domain: Hypothetical transcriptional regulator YfiR (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1RKTA:2-82; B:6-82CRYSTAL STRUCTURE OF YFIR, A PUTATIVE TRANSCRIPTIONAL REGULATOR FROM BACILLUS SUBTILIS
(-)
Protein domain: Hypothetical transcriptional regulator YsiA (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1VI0A:6-77; B:6-77CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR
(-)
Protein domain: Multidrug binding protein QacR (24)
(-)
Staphylococcus aureus [TaxId: 1280] (24)
1JT0A:2-72; B:2-72; C:2-72; D:2-72CRYSTAL STRUCTURE OF A COOPERATIVE QACR-DNA COMPLEX
1JT6A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING PROTEIN QACR BOUND TO DEQUALINIUM
1JTXA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR QACR BOUND TO CRYSTAL VIOLET
1JTYA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR QACR BOUND TO ETHIDIUM
1JUMA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO THE NATURAL DRUG BERBERINE
1JUPA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO MALACHITE GREEN
1JUSA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO RHODAMINE 6G
1QVTA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO THE DRUG PROFLAVINE
1QVUA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO TWO DRUGS: ETHIDIUM AND PROFLAVINE
1RKWA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO PENTAMADINE
1RPWA:2-72; B:2-72; C:2-72; D:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING PROTEIN QACR BOUND TO THE DIAMIDINE HEXAMIDINE
2DTZA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF MULTIDRUG BINDING PROTEIN QACR FROM STAPHYLOCOCCUS AUREUS COCRYSTALLIZED WITH COMPOUND DB75
2G0EA:2-72; B:2-72; D:2-72; E:2-72STRUCTURE OF QACR MULTIDRUG TRANSCRIPTIONAL REGULATOR BOUND TO TRIVALENT AND BIVALENT DIAMIDINE DRUGS
2GBYA:2-72; B:2-72; D:2-72; E:2-72STRUCTURE OF QACR MULTIDRUG TRANSCRIPTIONAL REGULATOR BOUND TO BIVALENT DIAMIDINE BERENIL
2HQ5A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF MULTIDRUG BINDING PROTEIN QACR FROM STAPHYLOCOCCUS AUREUS COCRYSTALLIZED WITH COMPOUND DB359
3BR0A:2-72; B:4-72CRYSTAL STRUCTURE OF THE COMPLEX OF MALACHITE GREEN BOUND TO QACR(E120Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BR3A:3-72; B:4-72CRYSTAL STRUCTURE OF THE COMPLEX OF ETHIDIUM BOUND TO QACR(E90Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BR5A:2-72; B:3-72; D:4-72; E:2-72CRYSTAL STRUCTURE OF THE COMPLEX OF RHODAMINE 6G BOUND TO QACR(E90Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BT9A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E57Q) BOUND TO DEQUALINIUM
3BTCA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E57Q) BOUND TO MALACHITE GREEN
3BTIA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO BERBERINE
3BTJA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO DEQUALINIUM
3BTLA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO MALACHITE GREEN
3PM1A:3-72; B:1-72STRUCTURE OF QACR E90Q BOUND TO ETHIDIUM
(-)
Protein domain: Probable transcriptional regulator PA1836 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2GENA:6-75STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PROBABLE TRANSCRIPTIONAL REGULATOR FROM PSEUDOMONAS AERUGINOSA PAO1
(-)
Protein domain: Probable transcriptional regulator PA3133 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2FD5A:1-76THE CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR FROM PSEUDOMONAS AERUGINOSA PAO1
(-)
Protein domain: Probable transcriptional regulator RHA1_ro04631 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2GFNA:4-80; B:7-80CRYSTAL STRUCTURE OF HTH-TYPE TRANSCRIPTIONAL REGULATOR PKSA RELATED PROTEIN FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative regulator SCO4008 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2D6YA:7-74; B:5-74CRYSTAL STRUCTURE OF TRANSCRIPTIONAL FACTOR SCO4008 FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative regulatory protein Sco4313 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2OI8A:8-86CRYSTAL STRUCTURE OF PUTATIVE REGULATORY PROTEIN SCO4313
(-)
Protein domain: Putative transcriptional regulator (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2G3BA:2-73; B:2-73CRYSTAL STRUCTURE OF PUTATIVE TETR-FAMILY TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP.
(-)
Protein domain: Putative transcriptional regulator Atu0279 (1)
(-)
Agrobacterium tumefaciens [TaxId: 358] (1)
2G7SA:3-76THE CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY, FROM AGROBACTERIUM TUMEFACIENS
(-)
Protein domain: Putative transcriptional regulator Rha04620 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2G7GA:9-73THE CRYSTAL STRUCTURE OF THE PUTATIVE TRANSCRIPTIONAL REGULATOR RHA04620 FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator RHA1_ro03468 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2HKUA:18-87; B:19-87STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator RHA1_ro09068 (1)
(-)
Rhodococcus sp. [TaxId: 1831] (1)
2I10A:10-78; B:11-78PUTATIVE TETR TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator SCO0857 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2NP3A:35-99; B:22-99CRYSTAL STRUCTURE OF TETR-FAMILY REGULATOR (SCO0857) FROM STREPTOMYCES COELICOLOR A3.
(-)
Protein domain: Putative transcriptional regulator SCO4850 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
3C07A:15-89; B:16-89CRYSTAL STRUCTURE OF A TETR FAMILY TRANSCRIPTIONAL REGULATOR FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative transcriptional regulator SCO4940 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2HYJA:8-82THE CRYSTAL STRUCTURE OF A TETR-FAMILY TRANSCRIPTIONAL REGULATOR FROM STREPTOMYCES COELICOLOR
(-)
Protein domain: Putative transcriptional regulator SCO5951 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2ID3A:13-80; B:14-80CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR SCO5951 FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative transcriptional regulator SCO7704 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2G7LA:16-83CRYSTAL STRUCTURE OF PUTATIVE TRANSCRIPTION REGULATOR SCO7704 FROM STREPTOMYCES COELICOR
(-)
Protein domain: Putative transcriptional regulator YxaF (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1SGMA:5-77; B:5-77CRYSTAL STRUCTURE OF HYPOTHETICAL PROTEIN YXAF
(-)
Protein domain: Putative transcriptional repressor YbiH (1)
(-)
Salmonella typhimurium [TaxId: 90371] (1)
1T33A:1-88; B:7-88STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REPRESSOR (TETR/ACRR FAMILY) FROM SALMONELLA TYPHIMURIM LT2
(-)
Protein domain: Tetracyclin repressor (Tet-repressor, TetR) (24)
(-)
Escherichia coli [TaxId: 562] (24)
1A6IA:2-67TET REPRESSOR, CLASS D VARIANT
1BJ0  [entry was replaced by entry 4V2F without any SCOP domain information]
1BJY  [entry was replaced by entry 4V2G without any SCOP domain information]
1BJZA:2-67TETRACYCLINE CHELATED MG2+-ION INITIATES HELIX UNWINDING FOR TET REPRESSOR INDUCTION
1ORKA:2-67TET REPRESSOR, CLASS D IN COMPLEX WITH 9-(N,N-DIMETHYLGLYCYLAMIDO)-6-DEMETHYL-6-DEOXY-TETRACYCLINE
1QPIA:4-67CRYSTAL STRUCTURE OF TETRACYCLINE REPRESSOR/OPERATOR COMPLEX
2FJ1A:2-67CRYSTAL STRUCTURE ANALYSIS OF TET REPRESSOR (CLASS D) IN COMPLEX WITH 7-CHLORTETRACYCLINE-NICKEL(II)
2NS7A:5-67; B:3-67; C:7-67; D:4-67HOW AN IN VITRO SELECTED PEPTIDE MIMICS THE ANTIBIOTIC TETRACYCLINE TO INDUCE TET REPRESSOR
2O7OA:2-67CRYSTAL STRUCTURE ANALYSIS OF TETR(D) COMPLEX WITH DOXYCYCLINE
2TCTA:2-67THE COMPLEX FORMED BETWEEN TET REPRESSOR AND TETRACYCLINE-MG2+ REVEALS MECHANISM OF ANTIBIOTIC RESISTANCE
2TRTA:2-67TETRACYCLINE REPRESSOR CLASS D
2VKEA:2-67TET REPRESSOR CLASS D COMPLEXED WITH COBALT AND TETRACYCLINE
2X6OA:2-67TET REPRESSOR CLASS D IN COMPLEX WITH 7-CHLOR-2-CYANO-ISO-TETRACYCLINE
2X9DA:2-67TET REPRESSOR (CLASS D) IN COMPLEX WITH ISO-7 CHLORTETRACYCLINE
2XB5A:2-67TET REPRESSOR (CLASS D) IN COMPLEX WITH 7-IODOTETRACYCLINE
2XPS  [entry was replaced by entry 4D7M without any SCOP domain information]
2XPT  [entry was replaced by entry 4D7N without any SCOP domain information]
2XPUA:2-67TETR(D) IN COMPLEX WITH ANHYDROTETRACYCLINE.
2XPVA:2-67TETR(D) IN COMPLEX WITH MINOCYCLINE AND MAGNESIUM.
2XPWA:2-67TETR(D) IN COMPLEX WITH OXYTETRACYCLINE AND MAGNESIUM.
3FK6A:4-67; B:3-67CRYSTAL STRUCTURE OF TETR TRIPLE MUTANT (H64K, S135L, S138I)
3FK7A:4-67; B:4-67CRYSTAL STRUCTURE OF TETR TRIPLE MUTANT (H64K, S135L, S138I) IN COMPLEX WITH 4-DDMA-ATC
4ABZA:2-67TETR(D) IN COMPLEX WITH TIGECYCLINE AND MAGNESIUM
4AUXA:2-67TET REPRESSOR CLASS D IN COMPLEX WITH 9-NITROTETRACYCLINE
(-)
Protein domain: Transcriptional activator DhaS (1)
(-)
Lactococcus lactis [TaxId: 1358] (1)
2IU5A:1-71; B:4-71DIHYDROXYACETONE KINASE OPERON ACTIVATOR DHAS
(-)
Protein domain: Transcriptional regulator BC3163 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2FQ4A:9-77THE CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR (TETR FAMILY) FROM BACILLUS CEREUS
(-)
Protein domain: Transcriptional regulator BC5000 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
1ZK8A:6-77; B:8-77CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR FROM BACILLUS CEREUS ATCC 14579
(-)
Protein domain: Transcriptional regulator Cgl1640/Cg1846 (1)
(-)
Corynebacterium glutamicum [TaxId: 1718] (1)
2O7TA:1-78CRYSTAL STRUCTURE OF A TETR FAMILY TRANSCRIPTIONAL REGULATOR (NCGL1578, CGL1640) FROM CORYNEBACTERIUM GLUTAMICUM AT 2.10 A RESOLUTION
(-)
Protein domain: Transcriptional regulator Cgl2612 (3)
(-)
Corynebacterium glutamicum [TaxId: 1718] (3)
2YVEA:1-74; B:3-74CRYSTAL STRUCTURE OF THE METHYLENE BLUE-BOUND FORM OF THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR
2ZOYA:1-74; B:3-74THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR (CGL2612 PROTEIN) FROM C.GLUTAMICUM
2ZOZA:3-73; B:1-73CRYSTAL STRUCTURE OF THE ETHIDIUM-BOUND FORM OF THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR
(-)
Protein domain: Transcriptional regulator EF0787 (1)
(-)
Enterococcus faecalis [TaxId: 1351] (1)
1Z0XA:4-71; B:3-71CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY FROM ENTEROCOCCUS FAECALIS V583
(-)
Protein domain: Transcriptional regulator PsrA (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2FBQA:2-80THE CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR PA3006
(-)
Protein domain: Transcriptional regulator RHA1_ro04179 (1)
(-)
Rhodococcus sp. [TaxId: 1831] (1)
2NP5A:9-77; B:9-77; C:10-77; D:10-77CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR (RHA1_RO04179) FROM RHODOCOCCUS SP. RHA1.
(-)
Protein domain: Transcriptional regulator TM1030 (8)
(-)
Thermotoga maritima [TaxId: 2336] (8)
1Z77A:1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR PROTEIN FROM THERMOTOGA MARITIMA.
1ZKGA:2-75; B:2-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY (TM1030) FROM THERMOTOGA MARITIMA AT 2.30 A RESOLUTION
2ID6A:-1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR (TM1030) AT 1.75A RESOLUTION
2IEKA:2-75NEW CRYSTAL FORM OF TRANSCRIPTIONAL REGULATOR TM1030 FROM THERMOTOGA MARITIMA
3IH2A:0-75TM1030 CRYSTALLIZED AT 323K
3IH3A:-1-75TM1030 CRYSTALLIZED AT 310K
3IH4A:-1-75TM1030 CRYSTALLIZED AT 277K
4I76A:3-75; B:1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR TM1030 WITH OCTANOL
(-)
Superfamily: KorB DNA-binding domain-like (2)
(-)
Family: KorB DNA-binding domain-like (2)
(-)
Protein domain: Putative partitioning protein ParB/Spo0J (1)
(-)
Thermus thermophilus [TaxId: 274] (1)
1VZ0A:116-208; B:116-208; C:116-208; D:116-208; E:116-208; F:116-208; G:116-208; H:116-208CHROMOSOME SEGREGATION PROTEIN SPO0J FROM THERMUS THERMOPHILUS
(-)
Protein domain: Transcriptional repressor protein KorB DNA-binding domain (1)
(-)
Escherichia coli [TaxId: 562] (1)
1R71A:; B:; C:; D:CRYSTAL STRUCTURE OF THE DNA BINDING DOMAIN OF KORB IN COMPLEX WITH THE OPERATOR DNA
(-)
Superfamily: Methylated DNA-protein cysteine methyltransferase, C-terminal domain (12)
(-)
Family: automated matches (3)
(-)
Protein domain: automated matches (3)
(-)
Human (Homo sapiens) [TaxId: 9606] (3)
3KZYA:92-179; B:92-179CRYSTAL STRUCTURE OF SNAP-TAG
3KZZA:92-179CRYSTAL STRUCTURE OF SNAP-TAG BOUND TO ITS SUBSTRATE BENZYLGUANINE
3L00A:92-179CRYSTAL STRUCTURE OF BENZYLATED SNAP-TAG
(-)
Family: Methylated DNA-protein cysteine methyltransferase, C-terminal domain (9)
(-)
Protein domain: Ada DNA repair protein (1)
(-)
Escherichia coli [TaxId: 562] (1)
1SFEA:93-176ADA O6-METHYLGUANINE-DNA METHYLTRANSFERASE FROM ESCHERICHIA COLI
(-)
Protein domain: O6-alkylguanine-DNA alkyltransferase (8)
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
1EH6A:92-181HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE
1EH7A:92-176METHYLATED HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE
1EH8A:92-179BENZYLATED HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE
1QNTA:92-176X-RAY STRUCTURE OF HUMAN O6ALKYLGUANINE-DNA ALKYLTRANSFERASE
1T38A:92-176HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE BOUND TO DNA CONTAINING O6-METHYLGUANINE
1T39A:92-175; B:92-174HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE COVALENTLY CROSSLINKED TO DNA
1YFHA:92-179; B:92-175; C:92-177WT HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE BOUND TO DNA CONTAINING AN ALKYLATED CYTOSINE
(-)
Pyrococcus kodakaraensis [TaxId: 311400] (1)
1MGTA:89-169CRYSTAL STRUCTURE OF O6-METHYLGUANINE-DNA METHYLTRANSFERASE FROM HYPERTHERMOPHILIC ARCHAEON PYROCOCCUS KODAKARAENSIS STRAIN KOD1
(-)
Superfamily: N-terminal Zn binding domain of HIV integrase (8)
(-)
Family: N-terminal Zn binding domain of HIV integrase (8)
(-)
Protein domain: N-terminal Zn binding domain of HIV integrase (8)
(-)
Human immunodeficiency virus type 1 [TaxId: 11676] (7)
1K6YA:1-46; B:1-46; C:1-46; D:1-46CRYSTAL STRUCTURE OF A TWO-DOMAIN FRAGMENT OF HIV-1 INTEGRASE
1WJAA:; B:SOLUTION STRUCTURE OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE (D FORM), NMR, REGULARIZED MEAN STRUCTURE
1WJBA:; B:SOLUTION STRUCTURE OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE (D FORM), NMR, 40 STRUCTURES
1WJCA:; B:SOLUTION STRUCTURE OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE (E FORM), NMR, REGULARIZED MEAN STRUCTURE
1WJDA:; B:SOLUTION STRUCTURE OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE (E FORM), NMR, 38 STRUCTURES
1WJEA:; B:SOLUTION STRUCTURE OF H12C MUTANT OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE COMPLEXED TO CADMIUM, NMR, MINIMIZED AVERAGE STRUCTURE
1WJFA:; B:SOLUTION STRUCTURE OF H12C MUTANT OF THE N-TERMINAL ZN BINDING DOMAIN OF HIV-1 INTEGRASE COMPLEXED TO CADMIUM, NMR, 40 STRUCTURES
(-)
Human immunodeficiency virus type 2 [TaxId: 11709] (1)
1E0EA:; B:N-TERMINAL ZINC-BINDING HHCC DOMAIN OF HIV-2 INTEGRASE
(-)
Superfamily: Polynucleotide phosphorylase/guanosine pentaphosphate synthase (PNPase/GPSI), domain 3 (3)
(-)
Family: Polynucleotide phosphorylase/guanosine pentaphosphate synthase (PNPase/GPSI), domain 3 (3)
(-)
Protein domain: Polynucleotide phosphorylase/guanosine pentaphosphate synthase (PNPase/GPSI), domain 3 (3)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1WHUA:SOLUTION STRUCTURE OF THE ALPHA-HELICAL DOMAIN FROM MOUSE HYPOTHETICAL PNPASE
(-)
Streptomyces antibioticus [TaxId: 1890] (2)
1E3HA:263-345SEMET DERIVATIVE OF STREPTOMYCES ANTIBIOTICUS PNPASE/GPSI ENZYME
1E3PA:263-345TUNGSTATE DERIVATIVE OF STREPTOMYCES ANTIBIOTICUS PNPASE/ GPSI ENZYME
(-)
Superfamily: Ribosomal protein L11, C-terminal domain (96)
(-)
Family: Ribosomal protein L11, C-terminal domain (96)
(-)
Protein domain: Ribosomal protein L11, C-terminal domain (96)
(-)
Bacillus stearothermophilus [TaxId: 1422] (8)
1ACIA:L11 RIBOSOMAL PROTEIN RNA BINDING DOMAIN, NMR, 20 STRUCTURES
1FOWA:NMR STRUCTURE OF L11-C76, THE C-TERMINAL DOMAIN OF 50S RIBOSOMAL PROTEIN L11, MINIMIZED AVERAGE STRUCTURE
1FOXA:NMR STRUCTURE OF L11-C76, THE C-TERMINAL DOMAIN OF 50S RIBOSOMAL PROTEIN L11, 33 STRUCTURES
1FOYA:THE RNA BINDING DOMAIN OF RIBOSOMAL PROTEIN L11: THREE-DIMENSIONAL STRUCTURE OF THE RNA-BOUND FORM OF THE PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE
1HC8A:; B:CRYSTAL STRUCTURE OF A CONSERVED RIBOSOMAL PROTEIN-RNA COMPLEX
1QA6A:; B:CRYSTAL STRUCTURE OF A CONSERVED RIBOSOMAL PROTEIN-RNA COMPLEX
1Y39A:2-75; B:205-275CO-EVOLUTION OF PROTEIN AND RNA STRUCTURES WITHIN A HIGHLY CONSERVED RIBOSOMAL DOMAIN
2FOWA:THE RNA BINDING DOMAIN OF RIBOSOMAL PROTEIN L11: THREE-DIMENSIONAL STRUCTURE OF THE RNA-BOUND FORM OF THE PROTEIN, NMR, 26 STRUCTURES
(-)
Deinococcus radiodurans [TaxId: 1299] (4)
1XBPG:72-143INHIBITION OF PEPTIDE BOND FORMATION BY PLEUROMUTILINS: THE STRUCTURE OF THE 50S RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS IN COMPLEX WITH TIAMULIN
2ZJPF:72-144THIOPEPTIDE ANTIBIOTIC NOSIHEPTIDE BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF DEINOCOCCUS RADIODURANS
2ZJQF:72-144INTERACTION OF L7 WITH L11 INDUCED BY MICROCCOCIN BINDING TO THE DEINOCOCCUS RADIODURANS 50S SUBUNIT
3CF5F:72-144THIOPEPTIDE ANTIBIOTIC THIOSTREPTON BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF DEINOCOCCUS RADIODURANS
(-)
Escherichia coli [TaxId: 562] (29)
2J28I:73-141MODEL OF E. COLI SRP BOUND TO 70S RNCS
2RDOI:73-14150S SUBUNIT WITH EF-G(GDPNP) AND RRF BOUND
3DEGH:73-141COMPLEX OF ELONGATING ESCHERICHIA COLI 70S RIBOSOME AND EF4(LEPA)-GMPPNP
(-)
Haloarcula marismortui [TaxId: 2238] (39)
1S72I:REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION
1VQ4I:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAA" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQ5I:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAA" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQ6I:71-140THE STRUCTURE OF C-HPMN AND CCA-PHE-CAP-BIO BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQ7I:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCA" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQ8I:71-140THE STRUCTURE OF CCDA-PHE-CAP-BIO AND THE ANTIBIOTIC SPARSOMYCIN BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQ9I:71-140THE STRUCTURE OF CCA-PHE-CAP-BIO AND THE ANTIBIOTIC SPARSOMYCIN BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQKI:71-140THE STRUCTURE OF CCDA-PHE-CAP-BIO BOUND TO THE A SITE OF THE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQLI:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DCSN" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQMI:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "DAN" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQNI:71-140THE STRUCTURE OF CC-HPMN AND CCA-PHE-CAP-BIO BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1VQOI:71-140THE STRUCTURE OF CCPMN BOUND TO THE LARGE RIBOSOMAL SUBUNIT HALOARCULA MARISMORTUI
1VQPI:71-140THE STRUCTURE OF THE TRANSITION STATE ANALOGUE "RAP" BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YHQI:66-135CRYSTAL STRUCTURE OF AZITHROMYCIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YI2I:66-135CRYSTAL STRUCTURE OF ERYTHROMYCIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YIJI:66-135CRYSTAL STRUCTURE OF TELITHROMYCIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YITI:66-135CRYSTAL STRUCTURE OF VIRGINIAMYCIN M AND S BOUND TO THE 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YJ9I:66-135CRYSTAL STRUCTURE OF THE MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI CONTAINING A THREE RESIDUE DELETION IN L22
1YJNI:66-135CRYSTAL STRUCTURE OF CLINDAMYCIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
1YJWI:66-135CRYSTAL STRUCTURE OF QUINUPRISTIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
2OTJI:71-14013-DEOXYTEDANOLIDE BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI
2OTLI:71-140GIRODAZOLE BOUND TO THE LARGE SUBUNIT OF HALOARCULA MARISMORTUI
2QA4I:67-130A MORE COMPLETE STRUCTURE OF THE THE L7/L12 STALK OF THE HALOARCULA MARISMORTUI 50S LARGE RIBOSOMAL SUBUNIT
2QEXI:71-134NEGAMYCIN BINDS TO THE WALL OF THE NASCENT CHAIN EXIT TUNNEL OF THE 50S RIBOSOMAL SUBUNIT
3CC2I:66-129THE REFINED CRYSTAL STRUCTURE OF THE HALOARCULA MARISMORTUI LARGE RIBOSOMAL SUBUNIT AT 2.4 ANGSTROM RESOLUTION WITH RRNA SEQUENCE FOR THE 23S RRNA AND GENOME-DERIVED SEQUENCES FOR R-PROTEINS
3CC4I:66-129CO-CRYSTAL STRUCTURE OF ANISOMYCIN BOUND TO THE 50S RIBOSOMAL SUBUNIT
3CC7I:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION C2487U
3CCEI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION U2535A
3CCJI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION C2534U
3CCLI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION U2535C. DENSITY FOR ANISOMYCIN IS VISIBLE BUT NOT INCLUDED IN MODEL.
3CCMI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION G2611U
3CCQI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION A2488U
3CCRI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION A2488C. DENSITY FOR ANISOMYCIN IS VISIBLE BUT NOT INCLUDED IN THE MODEL.
3CCSI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION G2482A
3CCUI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION G2482C
3CCVI:66-129STRUCTURE OF ANISOMYCIN RESISTANT 50S RIBOSOMAL SUBUNIT: 23S RRNA MUTATION G2616A
3CD6I:66-129CO-CYSTAL OF LARGE RIBOSOMAL SUBUNIT MUTANT G2616A WITH CC-PUROMYCIN
3CMAI:66-129THE STRUCTURE OF CCA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
3CMEI:66-129THE STRUCTURE OF CA AND CCA-PHE-CAP-BIO BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI
(-)
Thermotoga maritima [TaxId: 2336] (1)
1MMSA:71-140; B:CRYSTAL STRUCTURE OF THE RIBOSOMAL PROTEIN L11-RNA COMPLEX
(-)
Thermus thermophilus [TaxId: 274] (15)
2E34A:70-139L11 STRUCTURE WITH RDC AND RG REFINEMENT
2E35A:70-139THE MINIMIZED AVERAGE STRUCTURE OF L11 WITH RG REFINEMENT
2E36A:70-139L11 WITH SANS REFINEMENT
2H8WA:70-139SOLUTION STRUCTURE OF RIBOSOMAL PROTEIN L11
2NXNB:70-139T. THERMOPHILUS RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE (PRMA) IN COMPLEX WITH RIBOSOMAL PROTEIN L11
3CJQB:71-137; E:71-137; H:71-137RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE (PRMA) IN COMPLEX WITH DIMETHYLATED RIBOSOMAL PROTEIN L11 IN SPACE GROUP P212121
3CJRB:71-137RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE (PRMA) IN COMPLEX WITH RIBOSOMAL PROTEIN L11 (K39A) AND INHIBITOR SINEFUNGIN.
3CJTB:70-139; F:70-139; J:70-139; N:70-139RIBOSOMAL PROTEIN L11 METHYLTRANSFERASE (PRMA) IN COMPLEX WITH DIMETHYLATED RIBOSOMAL PROTEIN L11
(-)
Superfamily: Ribosomal protein S18 (71)
(-)
Family: Ribosomal protein S18 (71)
(-)
Protein domain: Ribosomal protein S18 (71)
(-)
Thermus thermophilus [TaxId: 274] (47)
1FJGR:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN COMPLEX WITH THE ANTIBIOTICS STREPTOMYCIN, SPECTINOMYCIN, AND PAROMOMYCIN
1G1XC:; H:STRUCTURE OF RIBOSOMAL PROTEINS S15, S6, S18, AND 16S RIBOSOMAL RNA
1HNWR:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN COMPLEX WITH TETRACYCLINE
1HNXR:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN COMPLEX WITH PACTAMYCIN
1HNZR:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN COMPLEX WITH HYGROMYCIN B
1HR0R:CRYSTAL STRUCTURE OF INITIATION FACTOR IF1 BOUND TO THE 30S RIBOSOMAL SUBUNIT
1I94R:CRYSTAL STRUCTURES OF THE SMALL RIBOSOMAL SUBUNIT WITH TETRACYCLINE, EDEINE AND IF3
1I95R:CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH EDEINE
1I96R:CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH THE TRANSLATION INITIATION FACTOR IF3 (C-TERMINAL DOMAIN)
1I97R:CRYSTAL STRUCTURE OF THE 30S RIBOSOMAL SUBUNIT FROM THERMUS THERMOPHILUS IN COMPLEX WITH TETRACYCLINE
1J5ER:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT
1N32R:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT BOUND TO CODON AND NEAR-COGNATE TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE FIRST CODON POSITION AT THE A SITE WITH PAROMOMYCIN
1N33R:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT BOUND TO CODON AND NEAR-COGNATE TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND CODON POSITION AT THE A SITE WITH PAROMOMYCIN
1N34R:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN THE PRESENCE OF CODON AND CRYSTALLOGRAPHICALLY DISORDERED NEAR-COGNATE TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE FIRST CODON POSITION
1N36R:STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT IN THE PRESENCE OF CRYSTALLOGRAPHICALLY DISORDERED CODON AND NEAR-COGNATE TRANSFER RNA ANTICODON STEM-LOOP MISMATCHED AT THE SECOND CODON POSITION
1X18H:16-88CONTACT SITES OF ERA GTPASE ON THE THERMUS THERMOPHILUS 30S SUBUNIT
1XMOR:CRYSTAL STRUCTURE OF MNM5U34T6A37-TRNALYSUUU COMPLEXED WITH AAG-MRNA IN THE DECODING CENTER
1XMQR:CRYSTAL STRUCTURE OF T6A37-ASLLYSUUU AAA-MRNA BOUND TO THE DECODING CENTER
1XNQR:STRUCTURE OF AN INOSINE-ADENINE WOBBLE BASE PAIR COMPLEX IN THE CONTEXT OF THE DECODING CENTER
1XNRR:CRYSTAL STRUCTURE OF AN INOSINE-CYTOSINE WOBBLE BASE PAIR IN THE CONTEXT OF THE DECODING CENTER
2E5LR:16-88A SNAPSHOT OF THE 30S RIBOSOMAL SUBUNIT CAPTURING MRNA VIA THE SHINE- DALGARNO INTERACTION
2F4VR:16-8830S RIBOSOME + DESIGNER ANTIBIOTIC
2HHHR:16-88CRYSTAL STRUCTURE OF KASUGAMYCIN BOUND TO THE 30S RIBOSOMAL SUBUNIT
2UU9R:19-88STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUG-CODON IN THE A-SITE AND PAROMOMYCIN.
2UUAR:19-88STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUC-CODON IN THE A-SITE AND PAROMOMYCIN.
2UUBR:19-88STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUU-CODON IN THE A-SITE AND PAROMOMYCIN.
2UUCR:19-88STRUCTURE OF THE THERMUS THERMOPHILUS 30S RIBOSOMAL SUBUNIT COMPLEXED WITH A VALINE-ASL WITH CMO5U IN POSITION 34 BOUND TO AN MRNA WITH A GUA-CODON IN THE A-SITE AND PAROMOMYCIN.
2UXBR:19-88CRYSTAL STRUCTURE OF AN EXTENDED TRNA ANTICODON STEM LOOP IN COMPLEX WITH ITS COGNATE MRNA GGGU IN THE CONTEXT OF THE THERMUS THERMOPHILUS 30S SUBUNIT.
2UXCR:19-88CRYSTAL STRUCTURE OF AN EXTENDED TRNA ANTICODON STEM LOOP IN COMPLEX WITH ITS COGNATE MRNA UCGU IN THE CONTEXT OF THE THERMUS THERMOPHILUS 30S SUBUNIT.
2UXDR:19-88CRYSTAL STRUCTURE OF AN EXTENDED TRNA ANTICODON STEM LOOP IN COMPLEX WITH ITS COGNATE MRNA CGGG IN THE CONTEXT OF THE THERMUS THERMOPHILUS 30S SUBUNIT.
2VQER:16-88MODIFIED URIDINES WITH C5-METHYLENE SUBSTITUENTS AT THE FIRST POSITION OF THE TRNA ANTICODON STABILIZE U-G WOBBLE PAIRING DURING DECODING
2VQFR:16-88MODIFIED URIDINES WITH C5-METHYLENE SUBSTITUENTS AT THE FIRST POSITION OF THE TRNA ANTICODON STABILIZE U-G WOBBLE PAIRING DURING DECODING
(-)
Superfamily: RNA polymerase subunit RPB10 (37)
(-)
Family: RNA polymerase subunit RPB10 (37)
(-)
Protein domain: automated matches (7)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (5)
2NVQJ:RNA POLYMERASE II ELONGATION COMPLEX IN 150 MM MG+2 WITH 2'DUTP
3CQZJ:CRYSTAL STRUCTURE OF 10 SUBUNIT RNA POLYMERASE II IN COMPLEX WITH THE INHIBITOR ALPHA-AMANITIN
3M3YJ:RNA POLYMERASE II ELONGATION COMPLEX C
3S1MJ:RNA POLYMERASE II INITIATION COMPLEX WITH A 5-NT RNA (VARIANT 1)
3S1NJ:RNA POLYMERASE II INITIATION COMPLEX WITH A 5-NT RNA (VARIANT 2)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3RZOJ:RNA POLYMERASE II INITIATION COMPLEX WITH A 4-NT RNA
(-)
Saccharomyces cerevisiae (1)
4C3IJ:STRUCTURE OF 14-SUBUNIT RNA POLYMERASE I AT 3.0 A RESOLUTION, CRYSTAL FORM C2-100
(-)
Protein domain: RNA polymerase subunit RPB10 (30)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (28)
1I3QJ:RNA POLYMERASE II CRYSTAL FORM I AT 3.1 A RESOLUTION
1I50J:RNA POLYMERASE II CRYSTAL FORM II AT 2.8 A RESOLUTION
1I6HJ:RNA POLYMERASE II ELONGATION COMPLEX
1K83J:CRYSTAL STRUCTURE OF YEAST RNA POLYMERASE II COMPLEXED WITH THE INHIBITOR ALPHA AMANITIN
1TWAJ:RNA POLYMERASE II COMPLEXED WITH ATP
1TWCJ:RNA POLYMERASE II COMPLEXED WITH GTP
1TWFJ:RNA POLYMERASE II COMPLEXED WITH UTP AT 2.3 A RESOLUTION
1TWGJ:RNA POLYMERASE II COMPLEXED WITH CTP
1TWHJ:RNA POLYMERASE II COMPLEXED WITH 2'DATP
2B63J:1-65COMPLETE RNA POLYMERASE II-RNA INHIBITOR COMPLEX
2B8KJ:1-6512-SUBUNIT RNA POLYMERASE II
2E2HJ:1-65RNA POLYMERASE II ELONGATION COMPLEX AT 5 MM MG2+ WITH GTP
2E2IJ:1-65RNA POLYMERASE II ELONGATION COMPLEX IN 5 MM MG+2 WITH 2'-DGTP
2E2JJ:1-65RNA POLYMERASE II ELONGATION COMPLEX IN 5 MM MG+2 WITH GMPCPP
2JA5J:1-65CPD LESION CONTAINING RNA POLYMERASE II ELONGATION COMPLEX A
2JA6J:1-65CPD LESION CONTAINING RNA POLYMERASE II ELONGATION COMPLEX B
2JA7J:1-65; V:1-65CPD LESION CONTAINING RNA POLYMERASE II ELONGATION COMPLEX C
2JA8J:1-65CPD LESION CONTAINING RNA POLYMERASE II ELONGATION COMPLEX D
2NVTJ:1-65RNA POLYMERASE II ELONGATION COMPLEX IN 150 MM MG+2 WITH GMPCPP
2NVXJ:1-65RNA POLYMERASE II ELONGATION COMPLEX IN 5 MM MG+2 WITH 2'-DUTP
2NVYJ:1-65RNA POLYMERASE II FORM II IN 150 MM MN+2
2NVZJ:1-65RNA POLYMERASE II ELONGATION COMPLEX WITH UTP, UPDATED 11/2006
2R7ZJ:1-65CISPLATIN LESION CONTAINING RNA POLYMERASE II ELONGATION COMPLEX
2R92J:1-65ELONGATION COMPLEX OF RNA POLYMERASE II WITH ARTIFICIAL RDRP SCAFFOLD
2R93J:1-65ELONGATION COMPLEX OF RNA POLYMERASE II WITH A HEPATITIS DELTA VIRUS-DERIVED RNA STEM LOOP
2VUMJ:1-65ALPHA-AMANITIN INHIBITED COMPLETE RNA POLYMERASE II ELONGATION COMPLEX
2YU9J:1-65RNA POLYMERASE II ELONGATION COMPLEX IN 150 MM MG+2 WITH UTP
4C2MJ:; Y:STRUCTURE OF RNA POLYMERASE I AT 2.8 A RESOLUTION
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3S14J:RNA POLYMERASE II INITIATION COMPLEX WITH A 6-NT RNA
(-)
Methanobacterium thermoautotrophicum [TaxId: 145262] (1)
1EF4A:SOLUTION STRUCTURE OF THE ESSENTIAL RNA POLYMERASE SUBUNIT RPB10 FROM METHANOBACTERIUM THERMOAUTOTROPHICUM
(-)
Superfamily: Rps17e-like (1)
(-)
Family: Rps17e-like (1)
(-)
Protein domain: ribosomal protein S17e (1)
(-)
Methanobacterium thermoautotrophicum [TaxId: 145262] (1)
1RQ6A:SOLUTION STRUCTURE OF RIBOSOMAL PROTEIN S17E FROM METHANOBACTERIUM THERMOAUTOTROPHICUM, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET TT802 / ONTARIO CENTER FOR STRUCTURAL PROTEOMICS TARGET MTH0803
(-)
Superfamily: Sigma3 and sigma4 domains of RNA polymerase sigma factors (41)
(-)
Family: automated matches (4)
(-)
Protein domain: automated matches (4)
(-)
Thermus thermophilus HB8 [TaxId: 300852] (3)
3DXJF:258-318; P:258-318; P:319-422; F:319-422CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH THE ANTIBIOTIC MYXOPYRONIN
4G7HF:258-318; F:319-423; P:258-318; P:319-423CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INITIATION COMPLEX
4G7OF:258-318; F:319-423; P:258-318; P:319-423CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS TRANSCRIPTION INITIATION COMPLEX CONTAINING 2 NT OF RNA
(-)
Thermus thermophilus [TaxId: 274] (1)
1ZYRF:258-318; F:319-423; P:258-318; P:319-423STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH THE ANTIBIOTIC STREPTOLYDIGIN
(-)
Family: Sigma3 domain (12)
(-)
Protein domain: Sigma factor SigA (1)
(-)
Thermus aquaticus [TaxId: 271] (1)
1KU2A:273-332; B:273-332CRYSTAL STRUCTURE OF THERMUS AQUATICUS RNA POLYMERASE SIGMA SUBUNIT FRAGMENT CONTAINING REGIONS 1.2 TO 3.1
(-)
Protein domain: Sigma factor sigma-28 (FliA) (2)
(-)
Aquifex aeolicus [TaxId: 63363] (2)
1RP3A:87-163; C:87-163; E:87-163; G:87-156COCRYSTAL STRUCTURE OF THE FLAGELLAR SIGMA/ANTI-SIGMA COMPLEX, SIGMA-28/FLGM
1SC5A:87-163SIGMA-28(FLIA)/FLGM COMPLEX
(-)
Protein domain: Sigma70 (9)
(-)
Thermus thermophilus [TaxId: 274] (9)
1IW7F:258-318; P:258-318CRYSTAL STRUCTURE OF THE RNA POLYMERASE HOLOENZYME FROM THERMUS THERMOPHILUS AT 2.6A RESOLUTION
1SMYF:258-318; P:258-318STRUCTURAL BASIS FOR TRANSCRIPTION REGULATION BY ALARMONE PPGPP
2A68F:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC RIFABUTIN
2A69F:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC RIFAPENTIN
2A6EF:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME
2A6HF:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC STERPTOLYDIGIN
2BE5F:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH INHIBITOR TAGETITOXIN
2CW0F:258-318; P:258-318CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE HOLOENZYME AT 3.3 ANGSTROMS RESOLUTION
3EQLF:258-318; P:258-318CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC MYXOPYRONIN
(-)
Family: Sigma4 domain (23)
(-)
Protein domain: automated matches (3)
(-)
Staphylococcus aureus [TaxId: 93061] (3)
4G6DA:G1 ORF67 / STAPHYLOCCUS AUREUS SIGMAA DOMAIN 4 COMPLEX
4G8XA:; C:G1 ORF67 / STAPHYLOCCUS AUREUS SIGMAA DOMAIN 4 COMPLEX
4G94A:G1 ORF67 / STAPHYLOCCUS AUREUS SIGMAA DOMAIN 4 COMPLEX
(-)
Protein domain: Sigma factor sigma-28 (FliA) (2)
(-)
Aquifex aeolicus [TaxId: 63363] (2)
1RP3A:164-234; C:164-235; E:164-236; G:167-236COCRYSTAL STRUCTURE OF THE FLAGELLAR SIGMA/ANTI-SIGMA COMPLEX, SIGMA-28/FLGM
1SC5A:168-233SIGMA-28(FLIA)/FLGM COMPLEX
(-)
Protein domain: Sigma70 (SigA, RpoD) (15)
(-)
Escherichia coli [TaxId: 562] (2)
1TLHB:T4 ASIA BOUND TO SIGMA70 REGION 4
2P7VB:CRYSTAL STRUCTURE OF THE ESCHERICHIA COLI REGULATOR OF SIGMA 70, RSD, IN COMPLEX WITH SIGMA 70 DOMAIN 4
(-)
Thermotoga maritima [TaxId: 2336] (1)
1TTYA:SOLUTION STRUCTURE OF SIGMA A REGION 4 FROM THERMOTOGA MARITIMA
(-)
Thermus aquaticus [TaxId: 271] (3)
1KU3A:CRYSTAL STRUCTURE OF THERMUS AQUATICUS RNA POLYMERASE SIGMA SUBUNIT FRAGMENT, REGION 4
1KU7A:; D:CRYSTAL STRUCTURE OF THERMUS AQUATICS RNA POLYMERASE SIGMAA SUBUNIT REGION 4 BOUND TO-35 ELEMENT DNA
1RIOH:STRUCTURE OF BACTERIOPHAGE LAMBDA CI-NTD IN COMPLEX WITH SIGMA-REGION4 OF THERMUS AQUATICUS BOUND TO DNA
(-)
Thermus thermophilus [TaxId: 274] (9)
1IW7F:319-423; P:319-423CRYSTAL STRUCTURE OF THE RNA POLYMERASE HOLOENZYME FROM THERMUS THERMOPHILUS AT 2.6A RESOLUTION
1SMYF:319-423; P:319-423STRUCTURAL BASIS FOR TRANSCRIPTION REGULATION BY ALARMONE PPGPP
2A68F:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC RIFABUTIN
2A69F:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC RIFAPENTIN
2A6EF:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME
2A6HF:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC STERPTOLYDIGIN
2BE5F:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH INHIBITOR TAGETITOXIN
2CW0F:319-423; P:319-423CRYSTAL STRUCTURE OF THERMUS THERMOPHILUS RNA POLYMERASE HOLOENZYME AT 3.3 ANGSTROMS RESOLUTION
3EQLF:319-423; P:319-423CRYSTAL STRUCTURE OF THE T. THERMOPHILUS RNA POLYMERASE HOLOENZYME IN COMPLEX WITH ANTIBIOTIC MYXOPYRONIN
(-)
Protein domain: SigmaE factor (RpoE) (2)
(-)
Escherichia coli [TaxId: 562] (2)
1OR7A:120-187; B:120-190CRYSTAL STRUCTURE OF ESCHERICHIA COLI SIGMAE WITH THE CYTOPLASMIC DOMAIN OF ITS ANTI-SIGMA RSEA
2H27A:122-190; D:122-190CRYSTAL STRUCTURE OF ESCHERICHIA COLI SIGMAE REGION 4 BOUND TO ITS-35 ELEMENT DNA
(-)
Protein domain: SigmaF (1)
(-)
Bacillus stearothermophilus [TaxId: 1422] (1)
1L0OC:CRYSTAL STRUCTURE OF THE BACILLUS STEAROTHERMOPHILUS ANTI-SIGMA FACTOR SPOIIAB WITH THE SPORULATION SIGMA FACTOR SIGMAF
(-)
Family: YlxM/p13-like (2)
(-)
Protein domain: Hypothetical protein SAV1236 (1)
(-)
Staphylococcus aureus, strain Mu50 / ATCC 700699 [TaxId: 1280] (1)
1XSVA:; B:X-RAY CRYSTAL STRUCTURE OF CONSERVED HYPOTHETICAL UPF0122 PROTEIN SAV1236 FROM STAPHYLOCOCCUS AUREUS SUBSP. AUREUS MU50
(-)
Protein domain: Hypothetical protein SPy1201 (1)
(-)
Streptococcus pyogenes [TaxId: 1314] (1)
1S7OA:; B:; C:CRYSTAL STRUCTURE OF PUTATIVE DNA BINDING PROTEIN SP_1288 FROM STREPTOCOCCUS PYGENES
(-)
Superfamily: TrpR-like (20)
(-)
Family: automated matches (1)
(-)
Protein domain: automated matches (1)
(-)
Rhodobacter sphaeroides [TaxId: 1063] (1)
2JRTA:NMR SOLUTION STRUCTURE OF THE PROTEIN CODED BY GENE RHOS4_12090 OF RHODOBACTER SPHAEROIDES. NORTHEAST STRUCTURAL GENOMICS TARGET RHR5
(-)
Family: Chromosomal replication initiation factor DnaA C-terminal domain IV (3)
(-)
Protein domain: Chromosomal replication initiation factor DnaA C-terminal domain IV (3)
(-)
Aquifex aeolicus [TaxId: 63363] (2)
1L8QA:290-399CRYSTAL STRUCTURE OF DNA REPLICATION INITIATION FACTOR
2HCBA:290-399; B:290-399; C:290-399; D:290-399STRUCTURE OF AMPPCP-BOUND DNAA FROM AQUIFEX AEOLICUS
(-)
Escherichia coli [TaxId: 562] (1)
1J1VA:CRYSTAL STRUCTURE OF DNAA DOMAINIV COMPLEXED WITH DNAABOX DNA
(-)
Family: SPO1678-like (1)
(-)
Protein domain: Uncharacterized protein SPO1678 (1)
(-)
Silicibacter pomeroyi [TaxId: 89184] (1)
2OA4A:1-93SOLUTION NMR STRUCTURE: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET SIR5
(-)
Family: Trp repressor, TrpR (15)
(-)
Protein domain: automated matches (1)
(-)
Escherichia coli [TaxId: 562] (1)
2XDIA:; B:TRYPTOPHAN REPRESSOR WITH L75F MUTATION IN ITS APO FORM (NO L-TRYPTOPHAN BOUND)
(-)
Protein domain: Trp repressor, TrpR (14)
(-)
Escherichia coli [TaxId: 562] (14)
1CO0A:; B:NMR STUDY OF TRP REPRESSOR-MTR OPERATOR DNA COMPLEX
1JHGA:TRP REPRESSOR MUTANT V58I
1MI7R:CRYSTAL STRUCTURE OF DOMAIN SWAPPED TRP APOREPRESSOR IN 30%(V/V) ISOPROPANOL
1RCSA:; B:NMR STUDY OF TRP REPRESSOR-OPERATOR DNA COMPLEX
1TROA:; C:; E:; G:CRYSTAL STRUCTURE OF TRP REPRESSOR OPERATOR COMPLEX AT ATOMIC RESOLUTION
1TRRA:; B:; D:; E:; G:; H:; J:; K:TANDEM BINDING IN CRYSTALS OF A TRP REPRESSOR/OPERATOR HALF-SITE COMPLEX
1WRPR:FLEXIBILITY OF THE DNA-BINDING DOMAINS OF TRP REPRESSOR
1WRSR:; S:NMR STUDY OF HOLO TRP REPRESSOR
1WRTR:; S:NMR STUDY OF APO TRP REPRESSOR
1ZT9A:; B:; D:; E:E. COLI TRP REPRESSOR, TETRAGONAL CRYSTAL FORM
2OZ9R:E. COLI TRP HOLOREPRESSOR, ORTHORHOMBIC CRYSTAL FORM
3SSWN:; R:E. COLI TRP APOREPRESSOR
3SSXN:; R:E. COLI TRP APOREPORESSOR L75F MUTANT
3WRPA:FLEXIBILITY OF THE DNA-BINDING DOMAINS OF TRP REPRESSOR
(-)
Superfamily: Winged helix DNA-binding domain (576)
(-)
Family: 39 kda initiator binding protein, IBP39, N-terminal domain (2)
(-)
Protein domain: 39 kda initiator binding protein, IBP39, N-terminal domain (2)
(-)
Trichomonas vaginalis [TaxId: 5722] (2)
1PP7U:CRYSTAL STRUCTURE OF THE T. VAGINALIS INITIATOR BINDING PROTEIN BOUND TO THE FERREDOXIN INR
1PP8F:; M:; O:; P:; U:; V:CRYSTAL STRUCTURE OF THE T. VAGINALIS IBP39 INITIATOR BINDING DOMAIN (IBD) BOUND TO THE ALPHA-SCS INR ELEMENT
(-)
Family: An Obfc1 domain (1)
(-)
Protein domain: OB fold-containing protein 1, Obfc1 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1WJ5A:SOLUTION STRUCTURE OF THE HYPOTHETICAL DOMAIN OF RIKEN CDNA 0610009H20
(-)
Family: Archaeal DNA-binding protein (2)
(-)
Protein domain: Sso10a (SSO10449) (2)
(-)
Sulfolobus solfataricus [TaxId: 2287] (2)
1R7JA:CRYSTAL STRUCTURE OF THE DNA-BINDING PROTEIN SSO10A FROM SULFOLOBUS SOLFATARICUS
1XSXA:; B:NMR STRUCTURE OF SSO10A, A HYPERTHERMOPHILE DNA-BINDING PROTEIN WITH AN EXTENDED ANTI-PARALLEL COILED COIL
(-)
Family: Arginine repressor (ArgR), N-terminal DNA-binding domain (5)
(-)
Protein domain: Arginine repressor (ArgR), N-terminal DNA-binding domain (5)
(-)
Bacillus stearothermophilus [TaxId: 1422] (1)
1B4AA:4-78; B:4-78; C:4-78; D:4-78; E:4-78; F:4-78STRUCTURE OF THE ARGININE REPRESSOR FROM BACILLUS STEAROTHERMOPHILUS
(-)
Bacillus subtilis [TaxId: 1423] (3)
1F9NA:3-78; B:1-78; C:2-78; D:4-78; E:2-78; F:1-78CRYSTAL STRUCTURE OF AHRC, THE ARGININE REPRESSOR/ACTIVATOR PROTEIN FROM BACILLUS SUBTILIS
2P5KA:CRYSTAL STRUCTURE OF THE N-TERMINAL DOMAIN OF AHRC
2P5LC:2-64; H:2-64; D:2-64; G:2-64CRYSTAL STRUCTURE OF A DIMER OF N-TERMINAL DOMAINS OF AHRC IN COMPLEX WITH AN 18BP DNA OPERATOR SITE
(-)
Escherichia coli [TaxId: 562] (1)
1AOYA:N-TERMINAL DOMAIN OF ESCHERICHIA COLI ARGININE REPRESSOR NMR, 23 STRUCTURES
(-)
Family: ArsR-like transcriptional regulators (13)
(-)
Protein domain: automated matches (4)
(-)
Staphylococcus aureus [TaxId: 1280] (3)
2KJBA:; B:SOLUTION STRUCTURE OF CZRA IN THE DNA BOUND STATE
2KJCA:; B:SOLUTION STRUCTURE OF CZRA IN THE ZN(II) STATE
3F72A:; B:; C:; D:; E:; F:CRYSTAL STRUCTURE OF THE STAPHYLOCOCCUS AUREUS PI258 CADC METAL BINDING SITE 2 MUTANT
(-)
Staphylococcus aureus [TaxId: 158879] (1)
4GGGA:; B:CRYSTAL STRUCTURE OF V66A/L68V CZRA IN THE ZN(II)BOUND STATE.
(-)
Protein domain: Cadmium efflux system accessory protein CadC (1)
(-)
Staphylococcus aureus [TaxId: 1280] (1)
1U2WA:12-119; B:; C:; D:CRYSTAL STRUCTURE OF THE STAPHYLOCOCCUS AUREUS PI258 CADC
(-)
Protein domain: Metal-sensing transcriptional repressor CzrA (3)
(-)
Staphylococcus aureus [TaxId: 1280] (3)
1R1UA:; B:; C:; D:CRYSTAL STRUCTURE OF THE METAL-SENSING TRANSCRIPTIONAL REPRESSOR CZRA FROM STAPHYLOCOCCUS AUREUS IN THE APO-FORM
1R1VA:; B:CRYSTAL STRUCTURE OF THE METAL-SENSING TRANSCRIPTIONAL REPRESSOR CZRA FROM STAPHYLOCOCCUS AUREUS IN THE ZN2-FORM
2M30A:; B:SOLUTION NMR REFINEMENT OF A METAL ION BOUND PROTEIN USING QUANTUM MECHANICAL/MOLECULAR MECHANICAL AND MOLECULAR DYNAMICS METHODS
(-)
Protein domain: Putative arsenical resistance operon repressor AF0168 (1)
(-)
Archaeoglobus fulgidus [TaxId: 2234] (1)
1Y0UA:; B:CRYSTAL STRUCTURE OF THE PUTATIVE ARSENICAL RESISTANCE OPERON REPRESSOR FROM ARCHAEOGLOBUS FULGIDUS
(-)
Protein domain: SmtB repressor (4)
(-)
Cyanobacteria (Synechococcus), pcc7942 [TaxId: 1129] (4)
1R1TA:; B:CRYSTAL STRUCTURE OF THE CYANOBACTERIAL METALLOTHIONEIN REPRESSOR SMTB IN THE APO-FORM
1R22A:; B:CRYSTAL STRUCTURE OF THE CYANOBACTERIAL METALLOTHIONEIN REPRESSOR SMTB (C14S/C61S/C121S MUTANT) IN THE ZN2ALPHA5-FORM
1R23A:; B:CRYSTAL STRUCTURE OF THE CYANOBACTERIAL METALLOTHIONEIN REPRESSOR SMTB IN THE ZN1-FORM (ONE ZN(II) PER DIMER)
1SMTA:; B:SMTB REPRESSOR FROM SYNECHOCOCCUS PCC7942
(-)
Family: automated matches (118)
(-)
Protein domain: automated matches (118)
(-)
Archaeoglobus fulgidus [TaxId: 2234] (1)
2P6UA:404-488APO STRUCTURE OF THE HEL308 SUPERFAMILY 2 HELICASE
(-)
Bacillus cereus [TaxId: 222523] (2)
3BJAA:CRYSTAL STRUCTURE OF PUTATIVE MARR-LIKE TRANSCRIPTION REGULATOR (NP_978771.1) FROM BACILLUS CEREUS ATCC 10987 AT 2.38 A RESOLUTION
4ESFA:CRYSTAL STRUCTURE OF PADR-LIKE TRANSCRIPTIONAL REGULATOR (BCE3449) FROM BACILLUS CEREUS STRAIN ATCC 10987
(-)
Bacillus cereus [TaxId: 226900] (2)
1YLFB:; C:X-RAY CRYSTAL STRUCTURE OF BC1842 PROTEIN FROM BACILLUS CEREUS, A MEMBER OF THE RRF2 FAMILY OF PUTATIVE TRANSCRIPTION REGULATORS.
4ESBA:CRYSTAL STRUCTURE OF PADR-LIKE TRANSCRIPTIONAL REGULATOR (BC4206) FROM BACILLUS CEREUS STRAIN ATCC 14579
(-)
Bacillus subtilis [TaxId: 1423] (6)
2FE3A:; B:THE CRYSTAL STRUCTURE OF BACILLUS SUBTILIS PERR-ZN REVEALS A NOVEL ZN(CYS)4 STRUCTURAL REDOX SWITCH
2HZTB:; C:; D:CRYSTAL STRUCTURE OF A PUTATIVE HTH-TYPE TRANSCRIPTIONAL REGULATOR YTCD
2RGVA:; B:THE CRYSTAL STRUCTURE OF PERR-OX HIGHLIGHTS 2-OXO-HISTIDINE FORMATION
3F8NA:; B:CRYSTAL STRUCTURE OF PERR-ZN-MN
4A5MA:; B:; C:; D:; E:; F:; G:; H:REDOX REGULATOR HYPR IN ITS OXIDIZED FORM
4A5NA:; B:; C:; D:REDOXREGULATOR HYPR IN ITS REDUCED FORM
(-)
Campylobacter jejuni [TaxId: 32022] (1)
4ETSA:; B:CRYSTAL STRUCTURE OF CAMPYLOBACTER JEJUNI FERRIC UPTAKE REGULATOR
(-)
Carboxydothermus hydrogenoformans [TaxId: 129958] (1)
2FMYA:139-219; B:1139-1219; C:2139-2219; D:3139-3219CO-DEPENDENT TRANSCRIPTION FACTOR COOA FROM CARBOXYDOTHERMUS HYDROGENOFORMANS (IMIDAZOLE-BOUND FORM)
(-)
Clarkia breweri [TaxId: 36903] (2)
3REOA:17-122; B:16-122; C:8-122; D:9-122MONOLIGNOL O-METHYLTRANSFERASE (MOMT)
3TKYA:16-122; B:9-122; C:16-122; D:9-122MONOLIGNOL O-METHYLTRANSFERASE (MOMT)
(-)
Clostridium acetobutylicum [TaxId: 1488] (1)
3JW4A:; B:; C:THE STRUCTURE OF A PUTATIVE MARR FAMILY TRANSCRIPTIONAL REGULATOR FROM CLOSTRIDIUM ACETOBUTYLICUM
(-)
Corynebacterium diphtheriae [TaxId: 1717] (1)
3GLXA:6-64CRYSTAL STRUCTURE ANALYSIS OF THE DTXR(E175K) COMPLEXED WITH NI(II)
(-)
Corynebacterium glutamicum [TaxId: 1718] (1)
3R6SA:148-227; B:148-227; C:148-226; D:148-226; E:148-227; F:148-227CRYSTAL STRUCTURE OF GLXR TRANSCRIPTION FACTOR FROM CORYNEBACTERIUM GLUTAMICUM WITH CAMP
(-)
Eggerthella lenta [TaxId: 479437] (1)
4EJOA:; B:CRYSTAL STRUCTURE OF PADR FAMILY TRANSCRIPTIONAL REGULATOR FROM EGGERTHELLA LENTA DSM 2243
(-)
Enterococcus faecalis [TaxId: 1351] (1)
3HHHA:; B:CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, A MEMBER OF PADR FAMILY, FROM ENTEROCOCCUS FAECALIS V583
(-)
Escherichia coli K-12 [TaxId: 83333] (13)
3FWEA:138-207; B:138-208CRYSTAL STRUCTURE OF THE APO D138L CAP MUTANT
3JSOA:2-69; B:2-69CLASSIC PROTEIN WITH A NEW TWIST: CRYSTAL STRUCTURE OF A LEXA REPRESSOR DNA COMPLEX
3JSPA:2-70; B:2-71CLASSIC PROTEIN WITH A NEW TWIST: CRYSTAL STRUCTURE OF A LEXA REPRESSOR DNA COMPLEX
3KCCA:138-206; B:138-206CRYSTAL STRUCTURE OF D138L MUTANT OF CATABOLITE GENE ACTIVATOR PROTEIN
3RDIA:138-207; B:138-207DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
3ROUA:138-207; B:138-207DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
3RPQA:138-207; B:138-208DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
4HZFA:139-208; B:139-209STRUCTURE OF THE WILD TYPE CATABOLITE GENE ACTIVATOR PROTEIN
4I01A:139-207; B:139-208STRUCTURE OF THE MUTANT CATABOLITE GEN ACTIVATOR PROTEIN V140L
4I02A:139-209; E:139-209; F:139-209; B:139-209; C:139-209; D:139-209STRUCTURE OF THE MUTANT CATABOLITE GENE ACTIVATOR PROTEIN V140A
4I09A:139-209; B:139-209STRUCTURE OF THE MUTANT CATABOLITE GENE ACTIVATOR PROTEIN V132L
4I0AA:139-207; B:139-208STRUCTURE OF THE MUTANT CATABOLITE GENE ACTIVATOR PROTEIN V132A
4I0BA:139-207; B:139-208STRUCTURE OF THE MUTANT CATABOLITE GENE ACTIVATOR PROTEIN H160L
(-)
Escherichia coli [TaxId: 469008] (1)
2WC2A:138-209; B:138-209NMR STRUCTURE OF CATABOLITE ACTIVATOR PROTEIN IN THE UNLIGANDED STATE
(-)
Helicobacter pylori [TaxId: 85962] (1)
2XIGA:; B:; C:; D:THE STRUCTURE OF THE HELICOBACTER PYLORI FERRIC UPTAKE REGULATOR FUR REVEALS THREE FUNCTIONAL METAL BINDING SITES
(-)
Human (Homo sapiens) [TaxId: 9606] (10)
2A07G:; K:; H:; I:; J:CRYSTAL STRUCTURE OF FOXP2 BOUND SPECIFICALLY TO DNA.
2AS5F:; G:STRUCTURE OF THE DNA BINDING DOMAINS OF NFAT AND FOXP2 BOUND SPECIFICALLY TO DNA.
2DLLA:SOLUTION STRUCTURE OF THE IRF DOMAIN OF HUMAN INTERFERON REGULATOR FACTORS 4
2LNBA:SOLUTION NMR STRUCTURE OF N-TERMINAL DOMAIN (6-74) OF HUMAN ZBP1 PROTEIN, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET HR8174A.
2ZMEA:34-175; A:176-250INTEGRATED STRUCTURAL AND FUNCTIONAL MODEL OF THE HUMAN ESCRT-II COMPLEX
3CUQA:34-175; A:176-252INTEGRATED STRUCTURAL AND FUNCTIONAL MODEL OF THE HUMAN ESCRT-II COMPLEX
4AVPA:; B:; C:; D:CRYSTAL STRUCTURE OF THE DNA-BINDING DOMAIN OF HUMAN ETV1.
4CO8A:STRUCTURE OF THE DNA BINDING ETS DOMAIN OF HUMAN ETV4
4IRGA:UNINHIBITED DNA-BINDING DOMAIN OF THE ETS TRANSCRIPTION FACTOR ERG
4IRHA:AUTO-INHIBITED ERG ETS DOMAIN
(-)
Lactobacillus plantarum [TaxId: 1590] (1)
3K69A:CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REGULATOR (LP_0360) FROM LACTOBACILLUS PLANTARUM AT 1.95 A RESOLUTION
(-)
Lactococcus lactis [TaxId: 416870] (3)
3F8BA:; B:CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR LMRR IN DRUG FREE STATE
3F8CA:CRYSTAL STRUCTURE OF MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR LMRR COMPLEXED WITH HOECHST 33342
3F8FA:; B:CRYSTAL STRUCTURE OF MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR LMRR COMPLEXED WITH DAUNOMYCIN
(-)
Linum nodiflorum [TaxId: 407264] (3)
4E70A:1-112; B:993-1112CRYSTAL STRUCTURE ANALYSIS OF CONIFERYL ALCOHOL 9-O-METHYLTRANSFERASE FROM LINUM NODIFLORUM IN COMPLEX WITH CONIFERYL ALCOHOL
4EMSA:1-112; B:-7-112CRYSTAL STRUCTURE ANALYSIS OF CONIFERYL ALCOHOL 9-O-METHYLTRANSFERASE FROM LINUM NODIFLORUM
4EVIA:1-112; B:-7-112CRYSTAL STRUCTURE ANALYSIS OF CONIFERYL ALCOHOL 9-O-METHYLTRANSFERASE FROM LINUM NODIFLORUM IN COMPLEX WITH CONIFERYL ALCOHOL 9-METHYL ETHER AND S -ADENOSYL-L-HOMOCYSTEINE
(-)
Lolium perenne [TaxId: 4522] (3)
3P9CA:9-116CRYSTAL STRUCTURE OF PERENNIAL RYEGRASS LPOMT1 BOUND TO SAH
3P9IA:4-116; B:5-116; C:4-116; D:10-116CRYSTAL STRUCTURE OF PERENNIAL RYEGRASS LPOMT1 COMPLEXED WITH S-ADENOSYL-L-HOMOCYSTEINE AND SINAPALDEHYDE
3P9KA:4-116; B:5-116; C:4-116; D:10-116CRYSTAL STRUCTURE OF PERENNIAL RYEGRASS LPOMT1 COMPLEXED WITH S-ADENOSYL-L-HOMOCYSTEINE AND CONIFERALDEHYDE
(-)
Medicago truncatula [TaxId: 3880] (5)
1ZG3A:7-116CRYSTAL STRUCTURE OF THE ISOFLAVANONE 4'-O-METHYLTRANSFERASE COMPLEXED WITH SAH AND 2,7,4'-TRIHYDROXYISOFLAVANONE
1ZGAA:8-116CRYSTAL STRUCTURE OF ISOFLAVANONE 4'-O-METHYLTRANSFERASE COMPLEXED WITH (+)-6A-HYDROXYMAACKIAIN
1ZGJA:11-116CRYSTAL STRUCTURE OF ISOFLAVANONE 4'-O-METHYLTRANSFERASE COMPLEXED WITH (+)-PISATIN
1ZHFA:8-116CRYSTAL STRUCTURE OF SELENOMETHIONINE SUBSTITUTED ISOFLAVANONE 4'-O-METHYLTRANSFERASE
2QYOA:5-113; B:6-113CRYSTAL STRUCTURE OF ISOFLAVONE O-METHYLTRANSFERASE HOMOLOG IN COMPLEX WITH BIOCHANIN A AND SAH
(-)
Methanobacterium thermoautotrophicum (2)
3BPVA:CRYSTAL STRUCTURE OF MARR
3BPXA:; B:CRYSTAL STRUCTURE OF MARR
(-)
Mouse (Mus musculus) [TaxId: 10090] (3)
2LF7A:INTRAMOLECULAR REGULATION OF THE ETS DOMAIN WITHIN ETV6 SEQUENCE R335 TO Q436
2MD5A:STRUCTURE OF UNINHIBITED ETV6 ETS DOMAIN
3QU3A:; B:; C:CRYSTAL STRUCTURE OF IRF-7 DBD APO FORM
(-)
Mycobacterium bovis [TaxId: 233413] (1)
3GW2A:CRYSTAL STRUCTURE OF POSSIBLE TRANSCRIPTIONAL REGULATORY PROTEIN (FRAGMENT 1-100) FROM MYCOBACTERIUM BOVIS. NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET MBR242E.
(-)
Mycobacterium tuberculosis [TaxId: 1773] (6)
2LKPA:; B:SOLUTION STRUCTURE OF APO-NMTR
2O03A:CRYSTAL STRUCTURE OF FURB FROM M. TUBERCULOSIS- A ZINC UPTAKE REGULATOR
3D0SA:145-224; B:145-215CAMP RECEPTOR PROTEIN FROM M.TUBERCULOSIS, CAMP-FREE FORM
3I54B:145-223; C:145-223; D:145-223CRYSTAL STRUCTURE OF MTBCRP IN COMPLEX WITH CAMP
3I59A:145-223; B:145-215CRYSTAL STRUCTURE OF MTBCRP IN COMPLEX WITH N6-CAMP
4A2UA:145-224; D:145-224; E:145-224; F:145-224; G:145-224; H:145-224; B:145-224; C:145-224CRP(CAP) FROM MYCO. TUBERCULOSIS, WITH CAMP
(-)
Mycobacterium tuberculosis [TaxId: 83332] (3)
2JSCA:; B:NMR STRUCTURE OF THE CADMIUM METAL-SENSOR CMTR FROM MYCOBACTERIUM TUBERCULOSIS
3H3UA:145-224; B:145-214CRYSTAL STRUCTURE OF CRP (CAMP RECEPTOR PROTEIN) FROM MYCOBACTERIUM TUBERCULOSIS
3MZHA:145-224; B:145-224CRYSTAL STRUCTURE OF CAMP RECEPTOR PROTEIN FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH CAMP AND ITS DNA BINDING ELEMENT
(-)
Neisseria meningitidis [TaxId: 122586] (3)
2P5VA:3-65; B:3-65; C:5-65; D:3-65; E:3-65; F:5-65; G:1-65; H:5-65CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR NMB0573 FROM NEISSERIA MENINGITIDIS
2P6SA:3-65; C:5-65; D:3-65; E:3-65; F:5-65; G:1-65; H:5-65; B:3-65CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR NMB0573/L-MET COMPLEX FROM NEISSERIA MENINGITIDIS
2P6TA:3-65; B:3-65; C:5-65; D:3-65; E:5-65; F:4-65; G:1-65; H:5-65CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR NMB0573 AND L-LEUCINE COMPLEX FROM NEISSERIA MENINGITIDIS
(-)
Nematode (Brugia malayi) [TaxId: 6279] (1)
2MBFA:SOLUTION STRUCTURE OF THE FORKHEAD DOMAIN OF BRUGIA MALAYI DAF-16A
(-)
Pseudomonas aeruginosa [TaxId: 208964] (1)
4GCVA:; B:; K:; L:; C:; D:; E:; F:; G:; H:; I:; J:STRUCTURE OF A PUTATIVE TRANSCRIPTION FACTOR (PA1374)FROM PSEUDOMONAS AERUGINOSA
(-)
Pyrococcus horikoshii [TaxId: 53953] (1)
2CYYA:1-64CRYSTAL STRUCTURE OF PH1519 FROM PYROCOCCUS HORIKOSII OT3
(-)
Silicibacter pomeroyi [TaxId: 246200] (2)
3CJNA:CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, MARR FAMILY, FROM SILICIBACTER POMEROYI
3E6MB:; C:; D:; F:; H:THE CRYSTAL STRUCTURE OF A MARR FAMILY TRANSCRIPTIONAL REGULATOR FROM SILICIBACTER POMEROYI DSS.
(-)
Silicibacter pomeroyi [TaxId: 89184] (1)
3E6MA:; E:; G:THE CRYSTAL STRUCTURE OF A MARR FAMILY TRANSCRIPTIONAL REGULATOR FROM SILICIBACTER POMEROYI DSS.
(-)
Slime mold (Dictyostelium discoideum) [TaxId: 44689] (1)
2M5WA:NMR SOLUTION STRUCTURE OF THE LA MOTIF (N-TERMINAL DOMAIN, NTD) OF DICTYOSTELIUM DISCOIDEUM LA PROTEIN
(-)
Staphylococcus aureus [TaxId: 1280] (5)
4HQMA:; B:THE CRYSTAL STRUCTURE OF QSRR-MENADIONE COMPLEX
4L9NA:; B:CRYSTAL STRUCTURE OF MEPR A103V MUTANT FROM MULTIDRUG RESISTANT S. AUREUS CLINICAL ISOLATE
4L9TA:; B:CRYSTAL STRUCTURE OF MEPR F27L MUTANT FROM MULTIDRUG RESISTANT S. AUREUS CLINICAL ISOLATE
4L9VA:CRYSTAL STRUCTURE OF SE-MET DERIVATIVE MEPR F27L MUTANT FROM MULTIDRUG RESISTANT S. AUREUS CLINICAL ISOLATE
4LD5A:; G:; H:; B:; C:; D:; E:; F:CRYSTAL STRUCTURE OF MEPR Q18P MUTANT FROM MULTIDRUG RESISTANT S. AUREUS CLINICAL ISOLATE
(-)
Staphylococcus aureus [TaxId: 158878] (1)
3ECOA:; B:CRYSTAL STRUCTURE OF MEPR, A TRANSCRIPTION REGULATOR OF THE STAPHYLOCOCCUS AUREUS MULTIDRUG EFFLUX PUMP MEPA
(-)
Staphylococcus aureus [TaxId: 426430] (4)
3HRMA:; B:CRYSTAL STRUCTURE OF STAPHYLOCOCCUS AUREUS PROTEIN SARZ IN SULFENIC ACID FORM
3HSEA:; B:CRYSTAL STRUCTURE OF STAPHYLOCOCCUS AUREUS PROTEIN SARZ IN REDUCED FORM
3HSRA:; B:; C:; D:CRYSTAL STRUCTURE OF STAPHYLOCOCCUS AUREUS PROTEIN SARZ IN MIXED DISULFIDE FORM
4GXOA:; B:CRYSTAL STRUCTURE OF STAPHYLOCOCCUS AUREUS PROTEIN SARZ MUTANT C13E
(-)
Staphylococcus epidermidis [TaxId: 176279] (1)
4HBLA:; B:; C:; D:CRYSTAL STRUCTURE OF ABFR OF STAPHYLOCOCCUS EPIDERMIDIS
(-)
Streptococcus mutans [TaxId: 210007] (1)
3L7WA:THE CRYSTAL STRUCTURE OF SMU.1704 FROM STREPTOCOCCUS MUTANS UA159
(-)
Streptococcus pyogenes [TaxId: 198466] (2)
4I7HA:; B:STRUCTURAL BASIS FOR PEROXIDE SENSING AND GENE REGULATION BY PERR FROM STREPTOCOCCUS PYOGENES
4LMYA:; B:STRUCTURE OF GAS PERR-ZN-ZN
(-)
Streptomyces coelicolor [TaxId: 1902] (2)
3EYYA:; B:STRUCTURAL BASIS FOR THE SPECIALIZATION OF NUR, A NICKEL-SPECIFIC FUR HOMOLOGUE, IN METAL SENSING AND DNA RECOGNITION
3MWMA:; B:GRADED EXPRESSION OF ZINC-RESPONSIVE GENES THROUGH TWO REGULATORY ZINC-BINDING SITES IN ZUR
(-)
Sulfolobus solfataricus [TaxId: 273057] (1)
4HW0A:; B:; C:CRYSTAL STRUCTURE OF SSO10A-2, A DNA-BINDING PROTEIN FROM SULFOLOBUS SOLFATARICUS
(-)
Sulfolobus tokodaii [TaxId: 111955] (3)
2E7WA:1-60CRYSTAL STRUCTURE OF THE LRP/ASNC LIKE TRANSCRIPTIONAL REGULATORS FROM SULFOLOBUS TOKODAII 7
2E7XA:1-60STRUCTURE OF THE LRP/ASNC LIKE TRANSCRIPTIONAL REGULATOR FROM SULFOLOBUS TOKODAII 7 COMPLEXED WITH ITS COGNATE LIGAND
2EFPA:1-60CRYSTAL STRUCTURE OF TYR77 TO ALA OF ST1022-GLUTAMINE COMPLEX FROM SULOLOBUS TOKODAII 7
(-)
Sulfolobus tokodaii [TaxId: 273063] (7)
2EFNA:1-60CRYSTAL STRUCTURE OF SER 32 TO ALA OF ST1022 FROM SULFOLOBUS TOKODAII 7
2EFOA:1-60CRYSTAL STRUCTURE OF TYR77 TO ALA OF ST1022 FROM SULFOLOBUS TOKODAII 7
2EFQA:1-60CRYSTAL STRUCTURE OF THR134 TO ALA OF ST1022-GLUTAMINE COMPLEX FROM SULFOLOBUS TOKODAII 7
2PMHA:1-60CRYSTAL STRUCTURE OF THR132ALA OF ST1022 FROM SULFOLOBUS TOKODAII
2PN6A:1-60CRYSTAL STRUCTURE OF S32A OF ST1022-GLN COMPLEX FROM SULFOLOBUS TOKODAII
2YX4A:1-60CRYSTAL STRUCTURE OF T134A OF ST1022 FROM SULFOLOBUS TOKODAII
2YX7A:1-60CRYSTALS STRUCTURE OF T132A MUTANT OF ST1022 FROM SULFOLOBUS TOKODAII 7
(-)
Thermoplasma acidophilum [TaxId: 2303] (1)
3ELKA:; B:CRYSTAL STRUCTURE OF PUTATIVE TRANSCRIPTIONAL REGULATOR TA0346 FROM THERMOPLASMA ACIDOPHILUM
(-)
Thermoplasma volcanium [TaxId: 50339] (1)
3DF8A:THE CRYSTAL STRUCTURE OF A POSSIBLE HXLR FAMILY TRANSCRIPTIONAL FACTOR FROM THERMOPLASMA VOLCANIUM GSS1
(-)
Thermotoga maritima [TaxId: 2336] (1)
3K2ZA:3-71; B:3-71CRYSTAL STRUCTURE OF A LEXA PROTEIN FROM THERMOTOGA MARITIMA
(-)
Vibrio cholerae [TaxId: 666] (1)
2W57A:; B:CRYSTAL STRUCTURE OF THE VIBRIO CHOLERAE FERRIC UPTAKE REGULATOR (FUR) REVEALS STRUCTURAL REARRANGEMENT OF THE DNA-BINDING DOMAINS
(-)
Xanthomonas campestris [TaxId: 339] (1)
2FA5A:; B:THE CRYSTAL STRUCTURE OF AN UNLIGANDED MULTIPLE ANTIBIOTIC-RESISTANCE REPRESSOR (MARR) FROM XANTHOMONAS CAMPESTRIS
(-)
Xanthomonas campestris [TaxId: 340] (1)
3IWZA:159-228; B:159-228; C:159-229; D:159-229THE C-DI-GMP RESPONSIVE GLOBAL REGULATOR CLP LINKS CELL-CELL SIGNALING TO VIRULENCE GENE EXPRESSION IN XANTHOMONAS CAMPESTRIS
(-)
Family: Biotin repressor-like (5)
(-)
Protein domain: Biotin repressor, N-terminal domain (4)
(-)
Escherichia coli [TaxId: 562] (4)
1BIAA:1-63THE E. COLI BIOTIN HOLOENZYME SYNTHETASE(SLASH)BIO REPRESSOR CRYSTAL STRUCTURE DELINEATES THE BIOTIN AND DNA-BINDING DOMAINS
1BIBA:2-63THE E. COLI BIOTIN HOLOENZYME SYNTHETASE(SLASH)BIO REPRESSOR CRYSTAL STRUCTURE DELINEATES THE BIOTIN AND DNA-BINDING DOMAINS
1HXDA:4-63; B:4-63CRYSTAL STRUCTURE OF E. COLI BIOTIN REPRESSOR WITH BOUND BIOTIN
2EWNA:3-63; B:2-63ECOLI BIOTIN REPRESSOR WITH CO-REPRESSOR ANALOG
(-)
Protein domain: Putative transcriptional regulator TM1602, N-terminal domain (1)
(-)
Thermotoga maritima [TaxId: 2336] (1)
1J5YA:3-67CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR (TM1602) FROM THERMOTOGA MARITIMA AT 2.3 A RESOLUTION
(-)
Family: C-terminal domain of RPA32 (2)
(-)
Protein domain: C-terminal domain of RPA32 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1DPUA:SOLUTION STRUCTURE OF THE C-TERMINAL DOMAIN OF HUMAN RPA32 COMPLEXED WITH UNG2(73-88)
1Z1DA:202-270STRUCTURAL MODEL FOR THE INTERACTION BETWEEN RPA32 C-TERMINAL DOMAIN AND SV40 T ANTIGEN ORIGIN BINDING DOMAIN.
(-)
Family: C-terminal domain of the rap74 subunit of TFIIF (4)
(-)
Protein domain: C-terminal domain of the rap74 subunit of TFIIF (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1I27A:CRYSTAL STRUCTURE OF THE C-TERMINAL DOMAIN OF THE RAP74 SUBUNIT OF HUMAN TRANSCRIPTION FACTOR IIF (TFIIF)
1J2XA:CRYSTAL STRUCTURE OF RAP74 C-TERMINAL DOMAIN COMPLEXED WITH FCP1 C-TERMINAL PEPTIDE
1NHAA:SOLUTION STRUCTURE OF THE CARBOXYL-TERMINAL DOMAIN OF RAP74 AND NMR CHARACTERIZATION OF THE FCP-BINDING SITES OF RAP74 AND CTD OF RAP74, THE SUBUNIT OF HUMAN TFIIF
1ONVA:NMR STRUCTURE OF A COMPLEX CONTAINING THE TFIIF SUBUNIT RAP74 AND THE RNAP II CTD PHOSPHATASE FCP1
(-)
Family: C-terminal fragment of elongation factor SelB (5)
(-)
Protein domain: automated matches (1)
(-)
Moorella thermoacetica [TaxId: 1525] (1)
2V9VA:377-437; A:438-511CRYSTAL STRUCTURE OF MOORELLA THERMOACETICA SELB(377-511)
(-)
Protein domain: C-terminal fragment of elongation factor SelB (4)
(-)
Moorella thermoacetica [TaxId: 1525] (4)
1LVAA:377-437; A:438-510; A:511-574; A:575-634CRYSTAL STRUCTURE OF A C-TERMINAL FRAGMENT OF MOORELLA THERMOACETICA ELONGATION FACTOR SELB
1WSUA:512-574; A:575-634; B:512-574; B:575-632; C:517-574; C:575-632; D:512-574; D:575-634C-TERMINAL DOMAIN OF ELONGATION FACTOR SELB COMPLEXED WITH SECIS RNA
2PLYA:392-437; A:438-510; A:511-574; A:575-632STRUCTURE OF THE MRNA BINDING FRAGMENT OF ELONGATION FACTOR SELB IN COMPLEX WITH SECIS RNA.
2UWMA:441-510; A:511-574; A:575-633; B:441-510; B:511-574; B:575-633C-TERMINAL DOMAIN(WH2-WH4) OF ELONGATION FACTOR SELB IN COMPLEX WITH SECIS RNA
(-)
Family: CAP C-terminal domain-like (39)
(-)
Protein domain: automated matches (2)
(-)
Listeria monocytogenes [TaxId: 169963] (2)
2BEOA:138-237; B:138-237PRFA, TRANSCRIPTIONAL REGULATOR IN LISTERIA MONOCYTOGENES
2BGCA:138-237; B:138-237; D:138-237; E:138-237; F:138-237; G:138-237; H:138-235; I:138-237PRFA-G145S, A CONSTITUTIVE ACTIVE MUTANT OF THE TRANSCRIPTIONAL REGULATOR IN L.MONOCYTOGENES
(-)
Protein domain: Catabolite gene activator protein (CAP), C-terminal domain (24)
(-)
Escherichia coli [TaxId: 562] (24)
1CGPA:138-205; B:138-205CATABOLITE GENE ACTIVATOR PROTEIN (CAP)/DNA COMPLEX + ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
1G6NA:138-206; B:438-5072.1 ANGSTROM STRUCTURE OF CAP-CAMP
1HW5A:138-208; B:138-205THE CAP/CRP VARIANT T127L/S128A
1I5ZA:138-206; B:138-207STRUCTURE OF CRP-CAMP AT 1.9 A
1I6XA:138-206; B:138-207STRUCTURE OF A STAR MUTANT CRP-CAMP AT 2.2 A
1J59A:138-207; B:138-205CATABOLITE GENE ACTIVATOR PROTEIN (CAP)/DNA COMPLEX + ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
1LB2A:138-209STRUCTURE OF THE E. COLI ALPHA C-TERMINAL DOMAIN OF RNA POLYMERASE IN COMPLEX WITH CAP AND DNA
1O3QA:138-207PROTEIN-DNA RECOGNITION AND DNA DEFORMATION REVEALED IN CRYSTAL STRUCTURES OF CAP-DNA COMPLEXES
1O3RA:138-207PROTEIN-DNA RECOGNITION AND DNA DEFORMATION REVEALED IN CRYSTAL STRUCTURES OF CAP-DNA COMPLEXES
1O3SA:138-207PROTEIN-DNA RECOGNITION AND DNA DEFORMATION REVEALED IN CRYSTAL STRUCTURES OF CAP-DNA COMPLEXES
1O3TA:138-207; B:138-205PROTEIN-DNA RECOGNITION AND DNA DEFORMATION REVEALED IN CRYSTAL STRUCTURES OF CAP-DNA COMPLEXES
1RUNA:138-209; B:138-205CATABOLITE GENE ACTIVATOR PROTEIN (CAP)/DNA COMPLEX + ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
1RUOA:138-206; B:138-209CATABOLITE GENE ACTIVATOR PROTEIN (CAP) MUTANT/DNA COMPLEX + ADENOSINE-3',5'-CYCLIC-MONOPHOSPHATE
1ZRCA:138-207; B:138-2074 CRYSTAL STRUCTURES OF CAP-DNA WITH ALL BASE-PAIR SUBSTITUTIONS AT POSITION 6, CAP-ICAP38 DNA
1ZRDA:138-207; B:138-2074 CRYSTAL STRUCTURES OF CAP-DNA WITH ALL BASE-PAIR SUBSTITUTIONS AT POSITION 6, CAP-[6A;17T]ICAP38 DNA
1ZREA:138-207; B:138-2074 CRYSTAL STRUCTURES OF CAP-DNA WITH ALL BASE-PAIR SUBSTITUTIONS AT POSITION 6, CAP-[6G;17C]ICAP38 DNA
1ZRFA:138-209; B:138-2074 CRYSTAL STRUCTURES OF CAP-DNA WITH ALL BASE-PAIR SUBSTITUTIONS AT POSITION 6, CAP-[6C;17G]ICAP38 DNA
2CGPA:138-207CATABOLITE GENE ACTIVATOR PROTEIN/DNA COMPLEX, ADENOSINE-3', 5'-CYCLIC-MONOPHOSPHATE
2GZWA:138-206; B:138-203; C:138-206; D:138-208CRYSTAL STRUCTURE OF THE E.COLI CRP-CAMP COMPLEX
3N4MA:138-209E. COLI RNA POLYMERASE ALPHA SUBUNIT C-TERMINAL DOMAIN IN COMPLEX WITH CAP AND DNA
3QOPA:138-207; B:138-207DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
3RYPA:138-207; B:138-208DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
3RYRA:138-207; B:138-208DOMAIN-DOMAIN FLEXIBILITY LEADS TO ALLOSTERY WITHIN THE CAMP RECEPTOR PROTEIN (CRP)
4FT8A:138-207; B:138-206E. COLI CATABOLITE ACTIVATOR PROTEIN WITH COBALT AND SULFATE LIGANDS
(-)
Protein domain: Chlorophenol reduction protein CprK (7)
(-)
Desulfitobacterium dehalogenans [TaxId: 36854] (1)
2H6CA:148-226; B:148-226CRYSTAL STRUCTURE OF REDUCED CPRK IN ABSENCE OF ANY LIGAND
(-)
Desulfitobacterium hafniense [TaxId: 49338] (6)
2H6BA:148-229; B:148-243CRYSTAL STRUCTURE OF OXIDIZED CPRK IN COMPLEX WITH O-CHLOROPHENOLACETIC ACID
3E5UA:148-227; B:148-226; C:148-227; D:148-228OCPA COMPLEXED CPRK (C200S)
3E5XA:148-222; B:148-227; C:148-222; D:148-228OCPA COMPLEXED CPRK
3E6BA:148-227; B:148-226OCPA COMPLEXED CPRK (C200S)
3E6CC:148-233CPRK OCPA DNA COMPLEX
3E6DA:149-226; B:149-228CRYSTAL STRUCTURE OF CPRK C200S
(-)
Protein domain: CO-sensing protein CooA, C-terminal domain (1)
(-)
Rhodospirillum rubrum [TaxId: 1085] (1)
1FT9A:134-213; B:134-213STRUCTURE OF THE REDUCED (FEII) CO-SENSING PROTEIN FROM R. RUBRUM
(-)
Protein domain: Cyclic AMP receptor-like protein Vfr (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2OZ6A:143-213CRYSTAL STRUCTURE OF VIRULENCE FACTOR REGULATOR FROM PSEUDOMONAS AERUGINOSA IN COMPLEX WITH CAMP
(-)
Protein domain: Listeriolysin regulatory protein PrfA, C-terminal domain (1)
(-)
Listeria monocytogenes [TaxId: 1639] (1)
1OMIA:1138-1237; B:2138-2237CRYSTAL STRUCTURE OF PRFA,THE TRANSCRIPTIONAL REGULATOR IN LISTERIA MONOCYTOGENES
(-)
Protein domain: Probable transcription regulator BT4300, C-terminal domain (1)
(-)
Bacteroides thetaiotaomicron [TaxId: 818] (1)
1ZYBA:148-220CRYSTAL STRUCTURE OF TRANSCRIPTION REGULATOR FROM BACTEROIDES THETAIOTAOMICRON VPI-5482 AT 2.15 A RESOLUTION
(-)
Protein domain: Transcriptional regulator PG0396, C-terminal domain (1)
(-)
Porphyromonas gingivalis [TaxId: 837] (1)
2GAUA:152-232CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, CRP/FNR FAMILY FROM PORPHYROMONAS GINGIVALIS (APC80792), STRUCTURAL GENOMICS, MCSG
(-)
Protein domain: Transcriptional regulator TTHA1359, C-terminal domain (1)
(-)
Thermus thermophilus [TaxId: 274] (1)
2ZCWA:117-198CRYSTAL STRUCTURE OF TTHA1359, A TRANSCRIPTIONAL REGULATOR, CRP/FNR FAMILY FROM THERMUS THERMOPHILUS HB8
(-)
Family: CED-4 C-terminal domain-like (1)
(-)
Protein domain: Cell death protein 4, CED-4 (1)
(-)
Nematode (Caenorhabditis elegans) [TaxId: 6239] (1)
2A5YB:386-543; C:386-543STRUCTURE OF A CED-4/CED-9 COMPLEX
(-)
Family: Cell cycle transcription factor e2f-dp (2)
(-)
Protein domain: Cell cycle transcription factor DP-2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1CF7B:STRUCTURAL BASIS OF DNA RECOGNITION BY THE HETERODIMERIC CELL CYCLE TRANSCRIPTION FACTOR E2F-DP
(-)
Protein domain: Cell cycle transcription factor E2F-4 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1CF7A:STRUCTURAL BASIS OF DNA RECOGNITION BY THE HETERODIMERIC CELL CYCLE TRANSCRIPTION FACTOR E2F-DP
(-)
Family: CodY HTH domain (1)
(-)
Protein domain: GTP-sensing transcriptional pleiotropic repressor CodY, C-terminal domain (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2B0LA:167-257; B:; C:C-TERMINAL DNA BINDING DOMAIN OF TRANSCRIPTIONAL PLEIOTROPIC REPRESSOR CODY.
(-)
Family: DEP domain (6)
(-)
Protein domain: Pleckstrin (3)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1W4MA:STRUCTURE OF THE HUMAN PLECKSTRIN DEP DOMAIN BY MULTIDIMENSIONAL NMR
2CSOA:8-122SOLUTION STRUCTURE OF THE DEP DOMAIN OF HUMAN PLECKSTRIN
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1UHWA:SOLUTION STRUCTURE OF THE DEP DOMAIN OF MOUSE PLECKSTRIN
(-)
Protein domain: Pleckstrin 2 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1V3FA:SOLUTION STRUCTURE OF THE DEP DOMAIN OF MOUSE PLECKSTRIN2
(-)
Protein domain: Regulatory domain of epac2, domain 2 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1O7FA:180-321CRYSTAL STRUCTURE OF THE REGULATORY DOMAIN OF EPAC2
(-)
Protein domain: Segment polarity protein Dishevelled-1 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1FSHA:STRUCTURAL BASIS OF THE RECOGNITION OF THE DISHEVELLED DEP DOMAIN IN THE WNT SIGNALING PATHWAY
(-)
Family: Dissimilatory sulfite reductase DsvD (2)
(-)
Protein domain: automated matches (1)
(-)
Desulfovibrio vulgaris [TaxId: 881] (1)
1WQ2A:; B:NEUTRON CRYSTAL STRUCTURE OF DISSIMILATORY SULFITE REDUCTASE D (DSRD)
(-)
Protein domain: Dissimilatory sulfite reductase DsvD (1)
(-)
Desulfovibrio vulgaris [TaxId: 881] (1)
1UCRA:; B:THREE-DIMENSIONAL CRYSTAL STRUCTURE OF DISSIMILATORY SULFITE REDUCTASE D (DSRD)
(-)
Family: DNA replication factor Cdt1 (1)
(-)
Protein domain: DNA replication factor Cdt1 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2ZXXC:; F:CRYSTAL STRUCTURE OF CDT1/GEMININ COMPLEX
(-)
Family: DNA-binding domain from rap30 (2)
(-)
Protein domain: DNA-binding domain from rap30 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1BBYA:DNA-BINDING DOMAIN FROM HUMAN RAP30, NMR, MINIMIZED AVERAGE
2BBYA:DNA-BINDING DOMAIN FROM HUMAN RAP30, NMR, 30 STRUCTURES
(-)
Family: DNA-binding protein Mj223 (1)
(-)
Protein domain: DNA-binding protein Mj223 (1)
(-)
Methanococcus jannaschii [TaxId: 2190] (1)
1KU9A:; B:X-RAY STRUCTURE OF A METHANOCOCCUS JANNASCHII DNA-BINDING PROTEIN: IMPLICATIONS FOR ANTIBIOTIC RESISTANCE IN STAPHYLOCOCCUS AUREUS
(-)
Family: ELL N2 domain-like (2)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2E5NA:SOLUTION STRUCTURE OF THE ELL_N2 DOMAIN OF TARGET OF RNA POLYMERASE II ELONGATION FACTOR ELL2
(-)
Protein domain: RNA polymerase II elongation factor ELL (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2DOAA:8-98SOLUTION STRUCTURE OF THE HELICAL DOMAIN IN HUMAN ELEVEN-NINETEEN LYSINE-RICH LEUKEMIA PROTEIN ELL
(-)
Family: ets domain (23)
(-)
Protein domain: automated matches (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (3)
2NNYA:; B:CRYSTAL STRUCTURE OF THE ETS1 DIMER DNA COMPLEX.
2YPRA:; B:CRYSTAL STRUCTURE OF THE DNA BINDING ETS DOMAIN OF HUMAN PROTEIN FEV
3RI4A:; D:ETS1 COOPERATIVE BINDING TO WIDELY SEPARATED SITES ON PROMOTER DNA
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
3JTGA:CRYSTAL STRUCTURE OF MOUSE ELF3 C-TERMINAL DNA-BINDING DOMAIN IN COMPLEX WITH TYPE II TGF-BETA RECEPTOR PROMOTER DNA
(-)
Protein domain: E74-like factor 5 ese-2b (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1WWXA:8-101SOLUTION STRUCTURE OF THE ETS-DOMAIN OF THE ETS DOMAIN TRANSCRIPTION FACTOR
(-)
Protein domain: Elk-1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1DUXC:; F:ELK-1/DNA STRUCTURE REVEALS HOW RESIDUES DISTAL FROM DNA-BINDING SURFACE AFFECT DNA-RECOGNITION
(-)
Protein domain: ETS-1 transcription factor, residues 331-440 (9)
(-)
Human (Homo sapiens) [TaxId: 9606] (3)
1GVJA:; B:ETS-1 DNA BINDING AND AUTOINHIBITORY DOMAINS
2STTA:SOLUTION NMR STRUCTURE OF THE HUMAN ETS1/DNA COMPLEX, 25 STRUCTURES
2STWA:SOLUTION NMR STRUCTURE OF THE HUMAN ETS1/DNA COMPLEX, RESTRAINED REGULARIZED MEAN STRUCTURE
(-)
Mouse (Mus musculus) [TaxId: 10090] (6)
1K78B:; F:PAX5(1-149)+ETS-1(331-440)+DNA
1K79A:; D:ETS-1(331-440)+GGAA DUPLEX
1K7AA:; D:ETS-1(331-440)+GGAG DUPLEX
1MD0A:; B:CRYSTAL STRUCTURE OF AN INHIBITED FRAGMENT OF ETS-1
1MDMB:INHIBITED FRAGMENT OF ETS-1 AND PAIRED DOMAIN OF PAX5 BOUND TO DNA
1R36A:NMR-BASED STRUCTURE OF AUTOINHIBITED MURINE ETS-1 DELTAN301
(-)
Protein domain: Fli-1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1FLIA:DNA-BINDING DOMAIN OF FLI-1
(-)
Protein domain: GA binding protein (GABP) alpha (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1AWCA:MOUSE GABP ALPHA/BETA DOMAIN BOUND TO DNA
(-)
Protein domain: Sam pointed domain containing ets transcription SPDEF (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1YO5C:247-334ANALYSIS OF THE 2.0A CRYSTAL STRUCTURE OF THE PROTEIN-DNA COMPLEX OF HUMAN PDEF ETS DOMAIN BOUND TO THE PROSTATE SPECIFIC ANTIGEN REGULATORY SITE
(-)
Protein domain: Serum response factor accessory protein 1a, SAP-1 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1BC7C:SERUM RESPONSE FACTOR ACCESSORY PROTEIN 1A (SAP-1)/DNA COMPLEX
1BC8C:STRUCTURES OF SAP-1 BOUND TO DNA SEQUENCES FROM THE E74 AND C-FOS PROMOTERS PROVIDE INSIGHTS INTO HOW ETS PROTEINS DISCRIMINATE BETWEEN RELATED DNA TARGETS
1HBXG:; H:TERNARY COMPLEX OF SAP-1 AND SRF WITH SPECIFIC SRE DNA
1K6OA:CRYSTAL STRUCTURE OF A TERNARY SAP-1/SRF/C-FOS SRE DNA COMPLEX
(-)
Protein domain: Transcription factor PU.1, residues 171-259 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1PUEE:; F:PU.1 ETS DOMAIN-DNA COMPLEX
(-)
Family: Eukaryotic translation initiation factor 3 subunit 12, eIF3k, C-terminal domain (1)
(-)
Protein domain: Eukaryotic translation initiation factor 3 subunit 12, eIF3k, C-terminal domain (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1RZ4A:132-216CRYSTAL STRUCTURE OF HUMAN EIF3K
(-)
Family: F112-like (1)
(-)
Protein domain: F-112 (1)
(-)
Sulfolobus virus-like particle SSV1 [TaxId: 244589] (1)
2VQCA:4-73STRUCTURE OF A DNA BINDING WINGED-HELIX PROTEIN, F-112, FROM SULFOLOBUS SPINDLE-SHAPED VIRUS 1.
(-)
Family: F93-like (4)
(-)
Protein domain: automated matches (1)
(-)
Sulfolobus turreted icosahedral virus [TaxId: 269145] (1)
2CO5B:F93 FROM STIV, A WINGED-HELIX DNA-BINDING PROTEIN
(-)
Protein domain: Hypothetical protein F93 (1)
(-)
Sulfolobus virus-like particle SSV1 [TaxId: 244589] (1)
1TBXA:; B:CRYSTAL STRUCTURE OF SSV1 F-93
(-)
Protein domain: STIV F93 (1)
(-)
Sulfolobus turreted icosahedral virus [TaxId: 269145] (1)
2CO5A:5-93F93 FROM STIV, A WINGED-HELIX DNA-BINDING PROTEIN
(-)
Protein domain: Uncharacterized protein APE0880.1 (1)
(-)
Aeropyrum pernix [TaxId: 56636] (1)
2PG4A:1-92; B:CRYSTAL STRUCTURE OF A PUTATIVE DNA BINDING PROTEIN (APE_0880A) FROM AEROPYRUM PERNIX K1 AT 2.21 A RESOLUTION
(-)
Family: FaeA-like (1)
(-)
Protein domain: P fimbrial regulatory protein PapI (1)
(-)
Escherichia coli [TaxId: 562] (1)
2HTJA:1-73NMR STRUCTURE OF E.COLI PAPI
(-)
Family: Forkhead DNA-binding domain (17)
(-)
Protein domain: Adipocyte-transcription factor FREAC-11 (s12, fkh-14) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1D5VA:SOLUTION STRUCTURE OF THE FORKHEAD DOMAIN OF THE ADIPOCYTE-TRANSCRIPTION FACTOR FREAC-11 (S12)
(-)
Protein domain: Afx (Foxo4) (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1E17A:SOLUTION STRUCTURE OF THE DNA BINDING DOMAIN OF THE HUMAN FORKHEAD TRANSCRIPTION FACTOR AFX (FOXO4)
3L2CA:CRYSTAL STRUCTURE OF THE DNA BINDING DOMAIN OF FOXO4 BOUND TO DNA
(-)
Protein domain: automated matches (9)
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
1VTNC:CO-CRYSTAL STRUCTURE OF THE HNF-3/FORK HEAD DNA-RECOGNITION MOTIF RESEMBLES HISTONE H5
2C6YA:; B:CRYSTAL STRUCTURE OF INTERLEUKIN ENHANCER-BINDING FACTOR 1 BOUND TO DNA
2K86A:SOLUTION STRUCTURE OF FOXO3A FORKHEAD DOMAIN
3CO6C:CRYSTAL STRUCTURE OF FOXO1 DBD BOUND TO DBE1 DNA
3CO7C:; F:CRYSTAL STRUCTURE OF FOXO1 DBD BOUND TO DBE2 DNA
3COAC:; F:CRYSTAL STRUCTURE OF FOXO1 DBD BOUND TO IRE DNA
3QRFF:; G:; H:; I:STRUCTURE OF A DOMAIN-SWAPPED FOXP3 DIMER
(-)
Mouse (Mus musculus) [TaxId: 10090] (2)
2A3SA:SOLUTION STRUCTURE AND DYNAMICS OF DNA-BINDING DOMAIN OF MYOCYTE NUCLEAR FACTOR
2D2WA:SOLUTION STRUCTURE AND DYNAMICS OF THE DNA-BINDING DOMAIN OF MYOCYTE NUCLEAR FACTOR
(-)
Protein domain: Forkhead box protein P2, FOXP2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2A07F:503-584CRYSTAL STRUCTURE OF FOXP2 BOUND SPECIFICALLY TO DNA.
(-)
Protein domain: Genesis (2)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (2)
2HDCA:STRUCTURE OF TRANSCRIPTION FACTOR GENESIS/DNA COMPLEX
2HFHA:THE NMR STRUCTURES OF A WINGED HELIX PROTEIN: GENESIS, 20 STRUCTURES
(-)
Protein domain: HFH-1 (HNF-3 forkhead homolog-1) (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1KQ8A:SOLUTION STRUCTURE OF WINGED HELIX PROTEIN HFH-1
(-)
Protein domain: Interleukin enhancer binding factor (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1JXSA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF INTERLEUKIN ENHANCER BINDING FACTOR
(-)
Family: FtsK C-terminal domain-like (4)
(-)
Protein domain: automated matches (2)
(-)
Pseudomonas aeruginosa [TaxId: 287] (2)
2VE8A:; B:; C:; D:; E:; F:; G:; H:XRAY STRUCTURE OF FTSK GAMMA DOMAIN (P. AERUGINOSA)
2VE9A:; C:; D:; E:; F:; B:XRAY STRUCTURE OF KOPS BOUND GAMMA DOMAIN OF FTSK (P. AERUGINOSA)
(-)
Protein domain: DNA translocase FtsK (2)
(-)
Escherichia coli [TaxId: 562] (1)
2J5PA:1261-1329E. COLI FTSK GAMMA DOMAIN
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2J5OA:742-811PSEUDOMONAS AERUGINOSA FTSK GAMMA DOMAIN
(-)
Family: FUR-like (1)
(-)
Protein domain: Ferric uptake regulation protein, FUR (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
1MZBA:FERRIC UPTAKE REGULATOR
(-)
Family: GntR-like transcriptional regulators (8)
(-)
Protein domain: Fatty acid responsive transcription factor FadR, N-terminal domain (5)
(-)
Escherichia coli [TaxId: 562] (5)
1E2XA:6-78FADR, FATTY ACID RESPONSIVE TRANSCRIPTION FACTOR FROM E. COLI
1H9GA:5-78FADR, FATTY ACID RESPONSIVE TRANSCRIPTION FACTOR FROM E. COLI, IN COMPLEX WITH MYRISTOYL-COA
1H9TA:5-78; B:5-78FADR, FATTY ACID RESPONSIVE TRANSCRIPTION FACTOR FROM E. COLI IN COMPLEX WITH FADB OPERATOR
1HW1A:5-78; B:5-78THE FADR-DNA COMPLEX: TRANSCRIPTIONAL CONTROL OF FATTY ACID METABOLISM IN ESCHERICHIA COLI
1HW2A:7-78; B:7-78FADR-DNA COMPLEX: TRANSCRIPTIONAL CONTROL OF FATTY ACID METABOLISM IN ECHERICHIA COLI
(-)
Protein domain: Putative transcriptional regulator RHA1_ro03477 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2HS5A:25-93STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REGULATOR GNTR FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Transcriptional regulator YydK (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
3BWGA:5-82; B:1-81; C:3-79THE CRYSTAL STRUCTURE OF POSSIBLE TRANSCRIPTIONAL REGULATOR YYDK FROM BACILLUS SUBTILIS SUBSP. SUBTILIS STR. 168
(-)
Protein domain: Transcriptional repressor TraR, N-terminal domain (1)
(-)
Streptomyces sp. [TaxId: 1931] (1)
1V4RA:1-100SOLUTION STRUCTURE OF STREPTMYCAL REPRESSOR TRAR
(-)
Family: Heat-inducible transcription repressor HrcA, N-terminal domain (1)
(-)
Protein domain: Heat-inducible transcription repressor HrcA, N-terminal domain (1)
(-)
Thermotoga maritima [TaxId: 2336] (1)
1STZA:14-100; B:11-95; C:11-95CRYSTAL STRUCTURE OF A HYPOTHETICAL PROTEIN AT 2.2 A RESOLUTION
(-)
Family: Heat-shock transcription factor (12)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2LDUA:SOLUTION NMR STRUCTURE OF HEAT SHOCK FACTOR PROTEIN 1 DNA BINDING DOMAIN FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET HR3023C
(-)
Protein domain: Heat-shock transcription factor (11)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (2)
1HKSA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF DROSOPHILA HEAT SHOCK TRANSCRIPTION FACTOR
1HKTA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF DROSOPHILA HEAT SHOCK TRANSCRIPTION FACTOR
(-)
Milk yeast (Kluyveromyces lactis) [TaxId: 28985] (9)
1FBQA:; B:HEAT SHOCK TRANSCRIPTION FACTOR DNA BINDING DOMAIN CONTAINING THE P237K MUTATION
1FBSA:; B:HEAT SHOCK TRANSCRIPTION FACTOR DNA BINDING DOMAIN CONTAINING THE P237A MUTATION
1FBUA:; B:HEAT SHOCK TRANSCRIPTION FACTOR DNA BINDING DOMAIN
1FYKA:SERENDIPITOUS CRYSTAL STRUCTURE CONTAINING THE HEAT SHOCK TRANSCRIPTION FACTOR'S DNA BINDING DOMAIN AND COGNATE DNA THAT IS TRANSLATIONALLY DISORDERED
1FYLA:; B:SERENDIPITOUS CRYSTAL STRUCTURE CONTAINING THE HEAT SHOCK TRANSCRIPTION FACTOR'S DNA BINDING DOMAIN AND COGNATE DNA IN A HEAD-TO-HEAD ORIENTATION
1FYMA:; B:SERENDIPITOUS CRYSTAL STRUCTURE CONTAINING THE HEAT SHOCK TRANSCRIPTION FACTOR'S DNA BINDING DOMAIN AND COGNATE DNA IN A TAIL-TO-TAIL ORIENTATION
2HTSA:CRYSTAL STRUCTURE OF THE DNA BINDING DOMAIN OF THE HEAT SHOCK TRANSCRIPTION FACTOR
3HSFA:HEAT SHOCK TRANSCRIPTION FACTOR (HSF)
3HTSB:HEAT SHOCK TRANSCRIPTION FACTOR/DNA COMPLEX
(-)
Family: Helicase DNA-binding domain (13)
(-)
Protein domain: CDC6, C-terminal domain (1)
(-)
Pyrobaculum aerophilum [TaxId: 13773] (1)
1FNNA:277-388; B:277-388CRYSTAL STRUCTURE OF CDC6P FROM PYROBACULUM AEROPHILUM
(-)
Protein domain: CDC6-like protein APE0152, C-terminal domain (2)
(-)
Aeropyrum pernix [TaxId: 56636] (2)
1W5SA:300-409; B:300-409STRUCTURE OF THE AEROPYRUM PERNIX ORC2 PROTEIN (ADP FORM)
1W5TA:300-409; B:300-409; C:300-409STRUCTURE OF THE AEROPYRUM PERNIX ORC2 PROTEIN (ADPNP-ADP COMPLEXES)
(-)
Protein domain: Holliday junction helicase RuvB (9)
(-)
Thermotoga maritima [TaxId: 2336] (6)
1IN4A:255-329THERMOTOGA MARITIMA RUVB HOLLIDAY JUNCTION BRANCH MIGRATION MOTOR
1IN5A:255-329THERMOGOTA MARITIMA RUVB A156S MUTANT
1IN6A:255-329THERMOTOGA MARITIMA RUVB K64R MUTANT
1IN7A:255-329THERMOTOGA MARITIMA RUVB R170A
1IN8A:255-329THERMOTOGA MARITIMA RUVB T158V
1J7KA:255-329THERMOTOGA MARITIMA RUVB P216G MUTANT
(-)
Thermus thermophilus [TaxId: 274] (3)
1HQCA:243-318; B:243-318STRUCTURE OF RUVB FROM THERMUS THERMOPHILUS HB8
1IXRC:243-312RUVA-RUVB COMPLEX
1IXSB:243-318STRUCTURE OF RUVB COMPLEXED WITH RUVA DOMAIN III
(-)
Protein domain: Hypothetical protein SSO1545, C-terminal domain (1)
(-)
Sulfolobus solfataricus [TaxId: 2287] (1)
2FNAA:284-356; B:284-356CRYSTAL STRUCTURE OF AN ARCHAEAL AAA+ ATPASE (SSO1545) FROM SULFOLOBUS SOLFATARICUS P2 AT 2.00 A RESOLUTION
(-)
Family: HxlR-like (6)
(-)
Protein domain: automated matches (1)
(-)
Enterococcus faecalis [TaxId: 226185] (1)
1Z7UB:CRYSTAL STRUCTURE OF THE PUTITIVE TRANSCRIPTIONAL REGULATOR OF MARR FAMILY FROM ENTEROCOCCUS FAECALIS V583
(-)
Protein domain: Hypothetical protein EF0647 (1)
(-)
Enterococcus faecalis [TaxId: 1351] (1)
1Z7UA:1-108CRYSTAL STRUCTURE OF THE PUTITIVE TRANSCRIPTIONAL REGULATOR OF MARR FAMILY FROM ENTEROCOCCUS FAECALIS V583
(-)
Protein domain: Hypothetical protein PA1607 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2F2EA:5-146; B:CRYSTAL STRUCTURE OF PA1607, A PUTATIVE TRANSCRIPTION FACTOR
(-)
Protein domain: Hypothetical protein PG0823 (1)
(-)
Porphyromonas gingivalis [TaxId: 837] (1)
2FSWA:3-104; B:CRYSTAL STRUCTURE OF THE PUTATIVE TRANSCRIPTIONAL REGUALATOR, MARR FAMILY FROM PORPHYROMONAS GINGIVALIS W83
(-)
Protein domain: Putative transcriptional regulator YtcD (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2HZTA:4-98CRYSTAL STRUCTURE OF A PUTATIVE HTH-TYPE TRANSCRIPTIONAL REGULATOR YTCD
(-)
Protein domain: Putative transcriptional regulator YtfH (1)
(-)
Salmonella typhimurium [TaxId: 90371] (1)
1YYVA:9-122; B:PUTATIVE TRANSCRIPTIONAL REGULATOR YTFH FROM SALMONELLA TYPHIMURIUM
(-)
Family: Hypothetical protein PH1932 (2)
(-)
Protein domain: Hypothetical protein PH1932 (2)
(-)
Pyrococcus horikoshii [TaxId: 53953] (2)
1ULYA:CRYSTAL STRUCTURE ANALYSIS OF THE ARSR HOMOLOGUE DNA-BINDING PROTEIN FROM P. HORIKOSHII OT3
2CWEA:2-192CRYSTAL STRUCTURE OF HYPOTHETICAL TRANSCRIPTIONAL REGULATOR PROTEIN, PH1932 FROM PYROCOCCUS HORIKOSHII OT3
(-)
Family: Hypothetical protein YhgG (3)
(-)
Protein domain: automated matches (2)
(-)
Klebsiella pneumoniae [TaxId: 573] (1)
4AWXB:MOONLIGHTING FUNCTIONS OF FEOC IN THE REGULATION OF FERROUS IRON TRANSPORT IN FEO
(-)
Klebsiella pneumoniae [TaxId: 72407] (1)
2K02A:SOLUTION STRUCTURE OF PUTATIVE FERROUS IRON TRANSPORT PROTEIN C (FEOC) OF KLEBSIELLA PNEUMONIAE
(-)
Protein domain: Hypothetical protein YhgG (1)
(-)
Escherichia coli [TaxId: 562] (1)
1XN7A:SOLUTION STRUCTURE OF E.COLI PROTEIN YHGG: THE NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET ET95
(-)
Family: Interferon regulatory factor (8)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
3QU6A:; B:; C:CRYSTAL STRUCTURE OF IRF-3 DBD FREE FORM
(-)
Protein domain: Interferon regulatory factor 1 (IRF-1) (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1IF1A:; B:INTERFERON REGULATORY FACTOR 1 (IRF-1) COMPLEX WITH DNA
(-)
Protein domain: Interferon regulatory factor 3, IRF-3 (3)
(-)
Human (Homo sapiens) [TaxId: 9606] (3)
1T2KA:; B:STRUCTURE OF THE DNA BINDING DOMAINS OF IRF3, ATF-2 AND JUN BOUND TO DNA
2O6GE:; F:; G:; H:CRYSTAL STRUCTURE OF IRF-3 BOUND TO THE INTERFERON-B ENHANCER
2PI0A:; B:; C:; D:CRYSTAL STRUCTURE OF IRF-3 BOUND TO THE PRDIII-I REGULATORY ELEMENT OF THE HUMAN INTERFERON-B ENHANCER
(-)
Protein domain: Interferon regulatory factor-2, IRF-2 (3)
(-)
Mouse (Mus musculus) [TaxId: 10090] (3)
1IRFA:INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, MINIMIZED AVERAGE STRUCTURE
1IRGA:INTERFERON REGULATORY FACTOR-2 DNA BINDING DOMAIN, NMR, 20 STRUCTURES
2IRFG:; H:; I:; J:; K:; L:CRYSTAL STRUCTURE OF AN IRF-2/DNA COMPLEX.
(-)
Family: Iron-dependent repressor protein (44)
(-)
Protein domain: automated matches (7)
(-)
Bacillus subtilis [TaxId: 1423] (3)
3R60A:4-62; B:4-62STRUCTURE OF THE MNTR FE2+ COMPLEX
3R61A:4-62; B:4-62STRUCTURE OF THE MNTR CO2+ COMPLEX
4HX4A:3-62; B:3-62STRUCTURE OF MNTR MUTANT E11K COMPLEXED WITH MN2+
(-)
Bacillus subtilis [TaxId: 224308] (4)
4HV5A:5-62; B:4-62STRUCTURE OF THE MNTR FE2+ COMPLEX WITH E SITE METAL BINDING
4HV6A:2-62; B:4-62STRUCTURE OF MNTR H77A MUTANT IN APO- AND MN-BOUND FORMS
4HX7A:4-62; B:3-62STRUCTURE OF MNTR E11K MUTANT COMPLEXED WITH CD2+
4HX8A:5-62; B:4-62STRUCTURE OF METAL-FREE MNTR MUTANT E11K
(-)
Protein domain: Diphtheria toxin repressor (DtxR) (20)
(-)
Corynebacterium diphtheriae [TaxId: 1717] (20)
1BI0A:4-64STRUCTURE OF APO-AND HOLO-DIPHTHERIA TOXIN REPRESSOR
1BI1A:4-64STRUCTURE OF APO-AND HOLO-DIPHTHERIA TOXIN REPRESSOR
1BI2A:3-64; B:3-64STRUCTURE OF APO-AND HOLO-DIPHTHERIA TOXIN REPRESSOR
1BI3A:4-64; B:4-64STRUCTURE OF APO-AND HOLO-DIPHTHERIA TOXIN REPRESSOR
1C0WA:2-64; B:2-64; C:2-64; D:2-64CRYSTAL STRUCTURE OF THE COBALT-ACTIVATED DIPHTHERIA TOXIN REPRESSOR-DNA COMPLEX REVEALS A METAL BINDING SH-LIKE DOMAIN
1DDNA:3-64; B:3-64; C:3-64; D:3-64DIPHTHERIA TOX REPRESSOR (C102D MUTANT)/TOX DNA OPERATOR COMPLEX
1DPRA:3-64; B:3-64STRUCTURES OF THE APO-AND METAL ION ACTIVATED FORMS OF THE DIPHTHERIA TOX REPRESSOR FROM CORYNEBACTERIUM DIPHTHERIAE
1F5TA:1002-1064; B:2002-2064; C:3002-3064; D:4002-4064DIPHTHERIA TOX REPRESSOR (C102D MUTANT) COMPLEXED WITH NICKEL AND DTXR CONSENSUS BINDING SEQUENCE
1FWZA:4-64GLU20ALA DTXR
1G3SA:4-64CYS102SER DTXR
1G3TA:3-64; B:1003-1064CYS102SER DTXR
1G3WA:4-64CD-CYS102SER DTXR
1G3YA:3-64ARG80ALA DTXR
1P92A:1-64CRYSTAL STRUCTURE OF (H79A)DTXR
1XCVA:1-64CRYSTAL STRUCTURE OF (H79AC102D)DTXR COMPLEXED WITH NICKEL(II)
2DTRA:4-64STRUCTURE OF DIPHTHERIA TOXIN REPRESSOR
2QQ9A:3-64CRYSTAL STRUCTURE OF DTXR(D6A C102D) COMPLEXED WITH NICKEL(II)
2QQAA:3-64CRYSTAL STRUCTURE OF DTXR(E9A C102D) COMPLEXED WITH NICKEL(II)
2QQBA:3-64CRYSTAL STRUCTURE OF DTXR(M10A C102D) COMPLEXED WITH NICKEL(II)
2TDXA:1-64DIPHTHERIA TOX REPRESSOR (C102D MUTANT) COMPLEXED WITH NICKEL
(-)
Protein domain: Iron-dependent regulator IdeR (6)
(-)
Mycobacterium tuberculosis [TaxId: 1773] (6)
1B1BA:1-64IRON DEPENDENT REGULATOR
1FX7A:1-64; B:1-64; C:1-64; D:1-64CRYSTAL STRUCTURE OF THE IRON-DEPENDENT REGULATOR (IDER) FROM MYCOBACTERIUM TUBERCULOSIS
1U8RA:1-64; B:1-64; C:1-64; D:1-64; G:1-64; H:1-64; I:1-64; J:1-64CRYSTAL STRUCTURE OF AN IDER-DNA COMPLEX REVEALS A CONFORMATIONAL CHANGE IN ACTIVATED IDER FOR BASE-SPECIFIC INTERACTIONS
2ISYA:2-64; B:2-64CRYSTAL STRUCTURE OF THE NICKEL-ACTIVATED TWO-DOMAIN IRON-DEPENDENT REGULATOR (IDER)
2ISZA:1-64; B:1-64; C:1-64; D:1-64CRYSTAL STRUCTURE OF A TWO-DOMAIN IDER-DNA COMPLEX CRYSTAL FORM I
2IT0A:3-64; B:3-64; C:3-64; D:3-64CRYSTAL STRUCTURE OF A TWO-DOMAIN IDER-DNA COMPLEX CRYSTAL FORM II
(-)
Protein domain: Manganese transport regulator MntR (11)
(-)
Bacillus subtilis [TaxId: 1423] (11)
1ON1A:2-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO MANGANESE, AB CONFORMATION.
1ON2A:2-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR), D8M MUTANT, BOUND TO MANGANESE
2EV0A:2-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO CADMIUM
2EV5A:3-62; B:4-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO CALCIUM
2EV6A:4-62; B:4-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO ZINC
2F5CA:3-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO MANGANESE, HEXAGONAL CRYSTAL FORM
2F5DA:3-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO MANGANESE, AC CONFORMATION, PH 6.5
2F5EA:2-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO MANGANESE, AB CONFORMATION, PH 6.5
2F5FA:4-62; B:2-62BACILLUS SUBTILIS MANGANESE TRANSPORT REGULATOR (MNTR) BOUND TO MANGANESE, AC CONFORMATION, PH 8.5
2HYFA:3-62; B:3-62; C:2-62; D:2-62THE STRUCTURE OF APO-MNTR FROM BACILLUS SUBTILIS, SELENOMETHIONINE DERIVATIVE
2HYGD:3-62THE STRUCTURE OF APO-MNTR FROM BACILLUS SUBTILIS, NATIVE FORM
(-)
Family: La domain (9)
(-)
Protein domain: La-related protein 4 LARP4 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CQKA:43-130SOLUTION STRUCTURE OF THE LA DOMAIN OF C-MPL BINDING PROTEIN
(-)
Protein domain: Lupus La autoantigen N-terminal domain (8)
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
1S7AA:NMR STRUCTURE OF THE LA MOTIF OF HUMAN LA PROTEIN
1YTYA:6-103; B:7-103STRUCTURAL BASIS FOR RECOGNITION OF UUUOH 3'-TERMINII OF NASCENT RNA POL III TRANSCRIPTS BY LA AUTOANTIGEN
1ZH5A:5-103; B:6-103STRUCTURAL BASIS FOR RECOGNITION OF UUUOH 3'-TERMINII OF NASCENT RNA POL III TRANSCRIPTS BY LA AUTOANTIGEN
2VODA:6-103; B:6-103CRYSTAL STRUCTURE OF N-TERMINAL DOMAINS OF HUMAN LA PROTEIN COMPLEXED WITH RNA OLIGOMER AUAUUUU
2VONA:6-103; B:7-103CRYSTAL STRUCTURE OF N-TERMINAL DOMAINS OF HUMAN LA PROTEIN COMPLEXED WITH RNA OLIGOMER AUAAUUU
2VOOA:10-103; B:9-103CRYSTAL STRUCTURE OF N-TERMINAL DOMAINS OF HUMAN LA PROTEIN COMPLEXED WITH RNA OLIGOMER UUUUUUUU
2VOPA:8-103CRYSTAL STRUCTURE OF N-TERMINAL DOMAINS OF HUMAN LA PROTEIN COMPLEXED WITH RNA OLIGOMER AUUUU
(-)
Trypanosome (Trypanosoma brucei) [TaxId: 5691] (1)
1S29A:LA AUTOANTIGEN N-TERMINAL DOMAIN
(-)
Family: LexA repressor, N-terminal DNA-binding domain (4)
(-)
Protein domain: LexA repressor, N-terminal DNA-binding domain (4)
(-)
Escherichia coli [TaxId: 562] (4)
1JHFA:2-72LEXA G85D MUTANT
1JHHA:2-72LEXA S119A MUTANT
1LEAA:SOLUTION STRUCTURE OF THE LEXA REPRESSOR DNA BINDING DETERMINED BY 1H NMR SPECTROSCOPY
1LEBA:SOLUTION STRUCTURE OF THE LEXA REPRESSOR DNA BINDING DETERMINED BY 1H NMR SPECTROSCOPY
(-)
Family: Linker histone H1/H5 (6)
(-)
Protein domain: Histone H1 homologue Hho1p (4)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (4)
1UHMA:SOLUTION STRUCTURE OF THE GLOBULAR DOMAIN OF LINKER HISTONE HOMOLOG HHO1P FROM S. CEREVISIAE
1USSA:YEAST HISTONE H1 GLOBULAR DOMAIN II, HHO1P GII, SOLUTION NMR STRUCTURES
1USTA:YEAST HISTONE H1 GLOBULAR DOMAIN I, HHO1P GI, SOLUTION NMR STRUCTURES
1YQAA:171-257ENGINEERING THE STRUCTURAL STABILITY AND FUNCTIONAL PROPERTIES OF THE GI DOMAIN INTO THE INTRINSICALLY UNFOLDED GII DOMAIN OF THE YEAST LINKER HISTONE HHO1P
(-)
Protein domain: Histone H1, globular domain (1)
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
1GHCA:HOMO-AND HETERONUCLEAR TWO-DIMENSIONAL NMR STUDIES OF THE GLOBULAR DOMAIN OF HISTONE H1: FULL ASSIGNMENT, TERTIARY STRUCTURE, AND COMPARISON WITH THE GLOBULAR DOMAIN OF HISTONE H5
(-)
Protein domain: Histone H5, globular domain (1)
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
1HSTA:; B:CRYSTAL STRUCTURE OF GLOBULAR DOMAIN OF HISTONE H5 AND ITS IMPLICATIONS FOR NUCLEOSOME BINDING
(-)
Family: Lrp/AsnC-like transcriptional regulator N-terminal domain (7)
(-)
Protein domain: LprA (1)
(-)
Pyrococcus furiosus [TaxId: 2261] (1)
1I1GA:2-61; B:2-61CRYSTAL STRUCTURE OF THE LRP-LIKE TRANSCRIPTIONAL REGULATOR FROM THE ARCHAEON PYROCOCCUS FURIOSUS
(-)
Protein domain: Putative transcriptional regulator PH1519 (4)
(-)
Pyrococcus horikoshii [TaxId: 53953] (4)
1RI7A:25-84CRYSTAL STRUCTURE OF A PROTEIN IN THE LRP/ASNC FAMILY FROM THE HYPERTHERMOPHILIC ARCHAEON PYROCOCCUS SP. OT3
2E1CA:24-84STRUCTURE OF PUTATIVE HTH-TYPE TRANSCRIPTIONAL REGULATOR PH1519/DNA COMPLEX
2ZNYA:25-84; B:25-84; C:25-84; D:25-84; E:25-84; F:25-84; G:25-84; H:25-84CRYSTAL STRUCTURE OF THE FFRP
2ZNZA:25-84; B:25-84; C:27-84; D:25-84; E:25-84; F:25-84; G:25-84; H:25-84CRYSTAL STRUCTURE OF FFRP
(-)
Protein domain: Regulatory protein AsnC (1)
(-)
Escherichia coli [TaxId: 562] (1)
2CG4A:4-66; B:4-66STRUCTURE OF E.COLI ASNC
(-)
Protein domain: Transcriptional regulator LrpC (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2CFXA:1-63; B:1-63; C:1-63; D:1-63; E:1-63; F:1-63; G:1-63; H:1-63STRUCTURE OF B.SUBTILIS LRPC
(-)
Family: LysR-like transcriptional regulators (3)
(-)
Protein domain: LysR-type regulatory protein CbnR (2)
(-)
Ralstonia eutropha [TaxId: 106590] (2)
1IXCA:1-89; B:1-89CRYSTAL STRUCTURE OF CBNR, A LYSR FAMILY TRANSCRIPTIONAL REGULATOR
1IZ1A:1-89; B:1-89; P:1-89; Q:1-89CRYSTAL STRUCTURE OF CBNR, A LYSR FAMILY TRANSCRIPTIONAL REGULATOR
(-)
Protein domain: Probable LysR-type transcriptional regulator PA0477 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2ESNA:3-91; B:2-91; C:2-91; D:3-91THE CRYSTAL STRUCTURE OF PROBABLE TRANSCRIPTIONAL REGULATOR PA0477 FROM PSEUDOMONAS AERUGINOSA
(-)
Family: Marine metagenome family WH1 (1)