Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  REFINED 1.8 ANGSTROM CRYSTAL STRUCTURE OF THE LAMBDA REPRESSOR-OPERATOR COMPLEX
 
Authors :  L. J. Beamer, C. O. Pabo
Date :  05 Nov 91  (Deposition) - 05 Nov 91  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.80
Chains :  Asym./Biol. Unit :  1,2,3,4
Keywords :  Protein-Dna Complex, Double Helix, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  L. J. Beamer, C. O. Pabo
Refined 1. 8 A Crystal Structure Of The Lambda Repressor-Operator Complex.
J. Mol. Biol. V. 227 177 1992
PubMed-ID: 1387915  |  Reference-DOI: 10.1016/0022-2836(92)90690-L
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA (5'- D(*AP*AP*TP*AP*CP*CP*AP*CP*TP*GP*GP*CP*GP*GP*TP*GP*A P*TP*AP*T)-3')
    Chains1
    EngineeredYES
    SyntheticYES
 
Molecule 2 - DNA (5'- D(*TP*AP*TP*AP*TP*CP*AP*CP*CP*GP*CP*CP*AP*GP*TP*GP*G P*TP*AP*T)-3')
    Chains2
    EngineeredYES
    SyntheticYES
 
Molecule 3 - PROTEIN (LAMBDA REPRESSOR)
    Chains3, 4
    Organism ScientificENTEROBACTERIA PHAGE LAMBDA
    Organism Taxid10710

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit 1234

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1LMB)

(-) Sites  (0, 0)

(no "Site" information available for 1LMB)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1LMB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1LMB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1LMB)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1HTH_CROC1PS50943 Cro/C1-type HTH domain profile.RPC1_LAMBD19-77
 
  23:18-76
4:18-76

(-) Exons   (0, 0)

(no "Exon" information available for 1LMB)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain 1 from PDB  Type:DNA  Length:20
                                                   
                  1lmb 1  1 AATACCACTGGCGGTGATAT 20
                                    10        20

Chain 2 from PDB  Type:DNA  Length:20
                                                   
                  1lmb 2 21 TATATCACCGCCAGTGGTAT 40
                                    30        40

Chain 3 from PDB  Type:PROTEIN  Length:87
 aligned with RPC1_LAMBD | P03034 from UniProtKB/Swiss-Prot  Length:237

    Alignment length:87
                                    16        26        36        46        56        66        76        86       
            RPC1_LAMBD    7 PLTQEQLEDARRLKAIYEKKKNELGLSQESVADKMGMGQSGVGALFNGINALNAYNAALLAKILKVSVEEFSPSIAREIYEMYEAVS 93
               SCOP domains d1lmb3_ 3: lambda C1 repressor, DNA-binding domain                                      SCOP domains
               CATH domains 1lmb300 3:6-92 lambda repressor-like DNA-binding domains                                CATH domains
               Pfam domains --------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhhhh.........hhhhhhh....hhhhhhhh.........hhhhhhhhh.........hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------HTH_CROC1  PDB: 3:18-76 UniProt: 19-77                     ---------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------- Transcript
                  1lmb 3  6 PLTQEQLEDARRLKAIYEKKKNELGLSQESVADKMGMGQSGVGALFNGINALNAYNAALLAKILKVSVEEFSPSIAREIYEMYEAVS 92
                                    15        25        35        45        55        65        75        85       

Chain 4 from PDB  Type:PROTEIN  Length:92
 aligned with RPC1_LAMBD | P03034 from UniProtKB/Swiss-Prot  Length:237

    Alignment length:92
                                    11        21        31        41        51        61        71        81        91  
            RPC1_LAMBD    2 STKKKPLTQEQLEDARRLKAIYEKKKNELGLSQESVADKMGMGQSGVGALFNGINALNAYNAALLAKILKVSVEEFSPSIAREIYEMYEAVS 93
               SCOP domains d1lmb4_ 4: lambda C1 repressor, DNA-binding domain                                           SCOP domains
               CATH domains 1lmb400 4:1-92 lambda repressor-like DNA-binding domains                                     CATH domains
           Pfam domains (1) --------------------HTH_3-1lmb401 4:21-76                                   ---------------- Pfam domains (1)
           Pfam domains (2) --------------------HTH_3-1lmb402 4:21-76                                   ---------------- Pfam domains (2)
         Sec.struct. author ........hhhhhhhhhhhhhhh.........hhhhhhh....hhhhhhhh.........hhhhhhhhh.........hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -----------------HTH_CROC1  PDB: 4:18-76 UniProt: 19-77                     ---------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------- Transcript
                  1lmb 4  1 STKKKPLTQEQLEDARRLKAIYEKKKNELGLSQESVADKMGMGQSGVGALFNGINALNAYNAALLAKILKVSVEEFSPSIAREIYEMYEAVS 92
                                    10        20        30        40        50        60        70        80        90  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Clan: HTH (544)

(-) Gene Ontology  (4, 4)

Asymmetric/Biological Unit(hide GO term definitions)
Chain 3,4   (RPC1_LAMBD | P03034)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
biological process
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1lmb)
 
  Sites
(no "Sites" information available for 1lmb)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1lmb)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1lmb
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  RPC1_LAMBD | P03034
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  RPC1_LAMBD | P03034
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        RPC1_LAMBD | P030341f39 1gfx 1j5g 1kca 1lli 1lrp 1lwq 1rio 3bdn 3kz3 3woa

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1LMB)