Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF CHICKEN LGP2 WITH 5'PPP 26-MER HAIRPIN RNA WITH 3' GG OVERHANG AND ADP-ALF4-MG2+ AT 2.0 A RESOLUTION.
 
Authors :  S. Cusack, E. Uchikawa
Date :  13 Apr 16  (Deposition) - 01 Jun 16  (Release) - 01 Jun 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.00
Chains :  Asym./Biol. Unit :  A,X
Keywords :  Innate Immune Pattern Recognition Receptor, Rig-I Like Helicase, Dsrna Dependent Atpase, Zinc-Containing Ctd Domain, Immune System (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  E. Uchikawa, M. Lethier, H. Malet, J. Brunel, D. Gerlier, S. Cusack
Structural Analysis Of Dsrna Binding To Anti-Viral Pattern Recognition Receptors Lgp2 And Mda5.
Mol. Cell V. 62 586 2016
PubMed-ID: 27203181  |  Reference-DOI: 10.1016/J.MOLCEL.2016.04.021

(-) Compounds

Molecule 1 - LGP2
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI BL21(DE3)
    Expression System Taxid: 469008
    Expression System Variant: ROSETTA 2
    Expression System Vector: PETM11SUMO
    Expression System Vector Type: PLASMID
    Mutation: YES
    Organism Common: CHICKEN
    Organism Scientific: GALLUS GALLUS
    Organism Taxid: 9031
 
Molecule 2 - RNA (5'- R(*GPPP*GP*AP*GP*CP*GP*UP*GP*CP*CP*GP*GP*GP*CP*AP*CP*GP*CP*UP*CP*CP*G P*G)-3')
    Chains: X
    Engineered: YES
    Mutation: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AX

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (6, 10)

Asymmetric/Biological Unit (6, 10)
No.NameCountTypeFull Name
1ADP1Ligand/IonADENOSINE-5'-DIPHOSPHATE
2ALF1Ligand/IonTETRAFLUOROALUMINATE ION
3GTP1Mod. NucleotideGUANOSINE-5'-TRIPHOSPHATE
4MG1Ligand/IonMAGNESIUM ION
5SO45Ligand/IonSULFATE ION
6ZN1Ligand/IonZINC ION

(-) Sites  (9, 9)

Asymmetric Unit (9, 9)
No.NameEvidenceResiduesDescription
1AC1SOFTWARECYS A:554 , CYS A:557 , CYS A:610 , CYS A:613binding site for residue ZN A 701
2AC2SOFTWARESER A:1 , GLU A:2 , LEU A:3 , HIS A:4 , GLN A:7 , GLY A:27 , ALA A:28 , GLY A:29 , LYS A:30 , THR A:31 , ARG A:32 , GLU A:67 , ASP A:444 , ARG A:471 , ALF A:703 , MG A:704 , HOH A:835 , HOH A:860 , HOH A:931 , HOH A:954binding site for residue ADP A 702
3AC3SOFTWARETHR A:26 , GLY A:27 , LYS A:30 , GLU A:132 , ALA A:168 , GLY A:442 , ARG A:469 , ARG A:471 , ADP A:702 , MG A:704 , HOH A:805 , HOH A:814 , HOH A:832 , HOH A:931 , HOH A:958binding site for residue ALF A 703
4AC4SOFTWAREADP A:702 , ALF A:703 , HOH A:814 , HOH A:835 , HOH A:931binding site for residue MG A 704
5AC5SOFTWAREHIS A:4 , GLY A:5 , TYR A:6 , GLN A:307 , ARG A:332binding site for residue SO4 A 705
6AC6SOFTWAREPHE A:178 , ARG A:503 , SER A:539 , ARG A:542 , GLN A:543binding site for residue SO4 A 706
7AC7SOFTWARETHR A:414 , ASN A:416 , LYS A:644 , HOH A:842binding site for residue SO4 A 707
8AC8SOFTWAREPHE A:273 , CYS A:274 , ARG A:275 , LYS A:276 , HOH A:829binding site for residue SO4 A 708
9AC9SOFTWARELYS A:56 , HIS A:135 , HOH A:885 , G X:20 , C X:21 , HOH X:212 , HOH X:217 , HOH X:228 , HOH X:232 , HOH X:238binding site for residue SO4 X 101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5JBG)

(-) Cis Peptide Bonds  (1, 1)

Asymmetric/Biological Unit
No.Residues
1Gln A:361 -Pro A:362

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5JBG)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5JBG)

(-) Exons   (0, 0)

(no "Exon" information available for 5JBG)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:661
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhhhh...eeee.....hhhhhhhhhhhhhhhh.....eeeee.hhhhhhhhhhhhhhhhhhh..eee.........hhhhhhhh..eeeeehhhhhhhhh........hhhhh.eeeee.hhhh...hhhhhhhhhhhhhhhh......eeeeee.........hhhhhhhhhhhhhhhhh..eee........eeeeeee.....hhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......eeee..hhhhhhhhhhhhhhhhhhh.....eeee............hhhhhhhhhhhhhh....eeee.hhhh.........eeeee....hhhhhhhhhh.......eeeeeee..hhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhh.eeee.....eeee...eeee...eeee...hhhh.eeeeeee.........eeeeeeeee.....eeeeeeee..eeeeee....eeee....eee..hhhhh.......hhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5jbg A   1 SELHGYQLEAVAPALRGRNSIVWLPTGAGKTRAAVHVCRRHLEGRRGGRVAVLVNKVHLVQQHLEKEFHVLRDAFKVTAVSGDSSHKCFFGQLAKGSDVVICTAQILQNALLSGEEEARVELTDFSLLVIDECHHTQKEAVYNKIMLSYLQKKLSGQRDLPQILGLTASPGTGGETSFEGAVEHILQICANLDTEVIASAQEVPQPTKQYDLCQEREQDPFGQRLKKIMAQIQEHMEMPELPQNFGTQVYEQRIVELENRAAERFCRKTRVCALHLRRYNDALLINDTVRMMDAFQCLQQFYADKKDPTERFLATTFEENRATLQALAGDQRYENPRLSKLEEILQEHFQPGSSRGIVFTKTRQSAHSLLSWLQDTAGLCGQHIRAAVLTGSGHSNQAKGMTQNEQQDVITLFRYGELNLLFSTSVAEEGLDIPECNIVVRYGLMTNEIAMVQAQGRARAQNSMYSVLAKANSREVYREQLNESLVGLMERAIRAVQAMPERKYRLKIVELQRNAVLSWQVKEARSSERRQLHDPDDVYFHCVNCNVAVCRGSDIRTVEAMHHVNINPNFRFYYTVSSGKIHFERTFRDWEPGCRIVCSECRQEWGMEMIYRNVTLPILSIKNFVVVTPDEKKKYKKWSTVTFPIEEFSYLEYCSSTQDES 673
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200 ||    218       228       238       248       258       268       278       288       298       308    || 321       331       341       351       361||     372       382       392       402       412       422       432       442       452       462       472       482       492       502       512       522       532       542       552       562       572       582       592       602       612       622       632       642       652       662       672 
                                                                                                                                                                                                                                   202|                                                                                                   313|                                          362|                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                    211                                                                                                    317                                           364                                                                                                                                                                                                                                                                                                                     


Chain X from PDB  Type:RNA  Length:23
                                                       
                 5jbg X   1 xGAGCGUGCCGGGCACGCUCCGG  26
                            |       10||      23   
                            1-GTP    11|           
                                      15
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5JBG)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5JBG)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5JBG)

(-) Gene Ontology  (4, 4)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ADP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ALF  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    GTP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Gln A:361 - Pro A:362   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5jbg
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  G0YYQ5_CHICK | G0YYQ5
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  G0YYQ5_CHICK | G0YYQ5
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/TrEMBL
        G0YYQ5_CHICK | G0YYQ5: 5jaj 5jb2 5jbj

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5JBG)