4BOC - JenaLib

Asymmetric Unit (Jmol Viewer)

Biological Unit 1 (Jmol Viewer)

Title :   STRUCTURE OF MITOCHONDRIAL RNA POLYMERASE ELONGATION COMPLEX

Authors :   K. Schwinghammer, A. Cheung, Y. Morozov, K. Agaronyan, D. Temiakov, P.

Date :   18 May 13 (Deposition) - 25 Sep 13 (Release) - 20 Nov 13 (Revision)

Method :   X-RAY DIFFRACTION

Resolution :   2.65

Chains :   Asym. Unit : A,N,R,T
Biol. Unit 1: A,N,R,T  (2x)

Keywords :   Transcription, Rna Polymerase, Mitochondria, Transferase, Dna-Rna Hybrid (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   K. Schwinghammer, A. C. M. Cheung, Y. I. Morozov, K. Agaronyan, D. Temiakov, P. Cramer
Structure Of Human Mitochondrial Rna Polymerase Elongation Complex
Nat. Struct. Mol. Biol. V. 20 1298 2013
PubMed-ID: 24096365 | Reference-DOI: 10.1038/NSMB.2683

Molecule 1 - DNA-DIRECTED RNA POLYMERASE, MITOCHONDRIAL
	Chains	:	A
	EC Number	:	2.7.7.6
	Engineered	:	YES
	Expression System	:	ESCHERICHIA COLI
	Expression System Plasmid	:	PPROEXHTB
	Expression System Taxid	:	562
	Expression System Vector Type	:	PLASMID
	Fragment	:	RESIDUES 151-1230
	Organism Common	:	HUMAN
	Organism Scientific	:	HOMO SAPIENS
	Organism Taxid	:	9606
	Synonym	:	MTRPOL, MITOCHONDRIAL RNA POLYMERASE

*Molecule 2 - 5'-D(CPGPTPCPTPGPGPCPGPTPGPCPGPCP GPCPCPGPCPTPAPCPCPCPCPAPTPG)-3'*
	Chains	:	T
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synonym	:	DNA TEMPLATE STRAND
	Synthetic	:	YES

*Molecule 3 - 5'-D(CPAPTPGPGPGPGPTPAPAPTPTPAPTP TPTPCPGPAPCPGPCPCPAPGPAPCPG)-3'*
	Chains	:	N
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synonym	:	DNA NON-TEMPLATE STRAND
	Synthetic	:	YES

*Molecule 4 - 5'-R(APGPUPCPUPGPCPGPGPCPGPCPGPCP)-3'*
	Chains	:	R
	Organism Scientific	:	SYNTHETIC CONSTRUCT
	Organism Taxid	:	32630
	Synonym	:	RNA PRODUCT STRAND
	Synthetic	:	YES

		1	2	3	4
Asymmetric Unit	:	A	N	R	T
Biological Unit 1 (2x)	:	A	N	R	T

Summary Information (see also Sequences/Alignments below)

(no "Ligand,Modified Residues,Ions" information available for 4BOC)

(no "Site" information available for 4BOC)

(no "SS Bond" information available for 4BOC)

Asymmetric Unit

No.	Residues
1	Ala A:290	-	Gly A:291
2	Gln A:363	-	Leu A:364
3	Lys A:419	-	Pro A:420
4	Gly A:557	-	Ala A:558
5	Pro A:742	-	Glu A:743
6	Pro A:747	-	His A:748
7	Ala A:750	-	Ala A:751
8	Gln A:1196	-	Lys A:1197

Asymmetric Unit (1, 1)

								dbSNP	PDB
No.	Source	Variant ID	Variant			UniProt ID	Status	ID	Chain	Variant
1	UniProt	VAR_019427	E	555	A	RPOM_HUMAN	Polymorphism	2238549	A	E	555	A

SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

Biological Unit 1 (1, 2)

								dbSNP	PDB
No.	Source	Variant ID	Variant			UniProt ID	Status	ID	Chain	Variant
1	UniProt	VAR_019427	E	555	A	RPOM_HUMAN	Polymorphism	2238549	A	E	555	A

SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

Asymmetric Unit (2, 2)

	PROSITE			UniProtKB		PDB
No.	ID	AC	Description	ID	Location	Count	Location
1	RNA_POL_PHAGE_1	PS00900	Bacteriophage-type RNA polymerase family active site signature 1.	RPOM_HUMAN	918-929	1	A:918-929
2	RNA_POL_PHAGE_2	PS00489	Bacteriophage-type RNA polymerase family active site signature 2.	RPOM_HUMAN	985-999	1	A:985-999

Biological Unit 1 (2, 4)

	PROSITE			UniProtKB		PDB
No.	ID	AC	Description	ID	Location	Count	Location
1	RNA_POL_PHAGE_1	PS00900	Bacteriophage-type RNA polymerase family active site signature 1.	RPOM_HUMAN	918-929	2	A:918-929
2	RNA_POL_PHAGE_2	PS00489	Bacteriophage-type RNA polymerase family active site signature 2.	RPOM_HUMAN	985-999	2	A:985-999

(no "Exon" information available for 4BOC)

Asymmetric Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:989
 aligned with RPOM_HUMAN | O00411 from UniProtKB/Swiss-Prot  Length:1230

    Alignment length:1013
                                   227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577       587       597       607       617       627       637       647       657       667       677       687       697       707       717       727       737       747       757       767       777       787       797       807       817       827       837       847       857       867       877       887       897       907       917       927       937       947       957       967       977       987       997      1007      1017      1027      1037      1047      1057      1067      1077      1087      1097      1107      1117      1127      1137      1147      1157      1167      1177      1187      1197      1207      1217      1227   
          RPOM_HUMAN    218 QLSGQQQRLLAFFKCCLLTDQLPLAHHLLVVHHGQRQKRKLLTLDMYNAVMLGWARQGAFKELVYVLFMVKDAGLTPDLLSYAAALQCMGRQDQDAGTIERCLEQMSQEGLKLQALFTAVLLSEEDRATVLKAVHKVKPTFSLPPQLPPPVNTSKLLRDVYAKDGRVSYPKLHLPLKTLQCLFEKQLHMELASRVCVVSVEKPTLPSKEVKHARKTLKTLRDQWEKALCRALRETKNRLEREVYEGRFSLYPFLCLLDEREVVRMLLQVLQALPAQGESFTTLARELSARTFSRHVVQRQRVSGQVQALQNHYRKYLCLLASDAEVPEPCLPRQYWEELGAPEALREQPWPLPVQMELGKLLAEMLVQATQMPCSLDKPHRSSRLVPVLYHVYSFRNVQQIGILKPHPAYVQLLEKAAEPTLTFEAVDVPMLCPPLPWTSPHSGAFLLSPTKLMRTVEGATQHQELLETCPPTALHGALDALTQLGNCAWRVNGRVLDLVLQLFQAKGCPQLGVPAPPSEAPQPPEAHLPHSAAPARKAELRRELAHCQKVAREMHSLRAEALYRLSLAQHLRDRVFWLPHNMDFRGRTYPCPPHFNHLGSDVARALLEFAQGRPLGPHGLDWLKIHLVNLTGLKKREPLRKRLAFAEEVMDDILDSADQPLTGRKWWMGAEEPWQTLACCMEVANAVRASDPAAYVSHLPVHQDGSCNGLQHYAALGRDSVGAASVNLEPSDVPQDVYSGVAAQVEVFRRQDAQRGMRVAQVLEGFITRKVVKQTVMTVVYGVTRYGGRLQIEKRLRELSDFPQEFVWEASHYLVRQVFKSLQEMFSGTRAIQHWLTESARLISHMGSVVEWVTPLGVPVIQPYRLDSKVKQIGGGIQSITYTHNGDISRKPNTRKQKNGFPPNFIHSLDSSHMMLTALHCYRKGLTFVSVHDCYWTHAADVSVMNQVCREQFVRLHSEPILQDLSRFLVKRFCSEPQKILEASQLKETLQAVPKPGAFDLEQVKRSTYFFS 1230
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh..hhhhhhhhh..hhhhhhhhhhhhhhhh..................hhhhhh............hhhhhhhhhhhhhhhhhhheeeee.......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhh..hhhhhhhhhhhhhhhh....eehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.............hhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhheee....---....eee.eeeeee......eeeeeehhhhhhhhhhhh..eeeee.hhh......eeeee..eee.............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhheeeehhhhhhhhhhhhh....hhhh...hhhhh............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....ee..eee.....eee.........hhhhhhheee...ee...hhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhh.....hhhhhh.hhhhhhhhhhhhhhhhh..hhhh.ee..eeeeee.hhhhhhhhhhh.hhhhhhhh.........hhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eee.....eee...ee.---------------------..eehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....ee...eeeee..hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.....hhhhhhhhhhhh........hhhhhhhh...ee Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------A--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------RNA_POL_PHAG-------------------------------------------------------RNA_POL_PHAGE_2--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                4boc A  218 QLSGQQQRLLAFFKCCLLTDQLPLAHHLLVVHHGQRQKRKLLTLDMYNAVMLGWARQGAFKELVYVLFMVKDAGLTPDLLSYAAALQCMGRQDQDAGTIERCLEQMSQEGLKLQALFTAVLLSEEDRATVLKAVHKVKPTFSLPPQLPPPVNTSKLLRDVYAKDGRVSYPKLHLPLKTLQCLFEKQLHMELASRVCVVSVEKPTLPSKEVKHARKTLKTLRDQWEKALCRALRETKNRLEREVYEGRFSLYPFLCLLDEREVVRMLLQVLQALPAQGESFTTLARELSARTFSRHVVQRQRVSGQVQALQNHYRKYLCLLASDAEVPEPCLPRQYWEELGAPEALREQPWPLPVQMELGKLLAEMLVQATQMPCSLD---RSSRLVPVLYHVYSFRNVQQIGILKPHPAYVQLLEKAAEPTLTFEAVDVPMLCPPLPWTSPHSGAFLLSPTKLMRTVEGATQHQELLETCPPTALHGALDALTQLGNCAWRVNGRVLDLVLQLFQAKGCPQLGVPAPPSEAPQPPEAHLPHSAAPARKAELRRELAHCQKVAREMHSLRAEALYRLSLAQHLRDRVFWLPHNMDFRGRTYPCPPHFNHLGSDVARALLEFAQGRPLGPHGLDWLKIHLVNLTGLKKREPLRKRLAFAEEVMDDILDSADQPLTGRKWWMGAEEPWQTLACCMEVANAVRASDPAAYVSHLPVHQDGSCNGLQHYAALGRDSVGAASVNLEPSDVPQDVYSGVAAQVEVFRRQDAQRGMRVAQVLEGFITRKVVKQTVMTVVYGVTRYGGRLQIEKRLRELSDFPQEFVWEASHYLVRQVFKSLQEMFSGTRAIQHWLTESARLISHMGSVVEWVTPLGVPVIQPYRLD---------------------SRKPNTRKQKNGFPPNFIHSLDSSHMMLTALHCYRKGLTFVSVHDCYWTHAADVSVMNQVCREQFVRLHSEPILQDLSRFLVKRFCSEPQKILEASQLKETLQAVPKPGAFDLEQVKRSTYFFS 1230
                                   227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577       587      |  -|      607       617       627       637       647       657       667       677       687       697       707       717       727       737       747       757       767       777       787       797       807       817       827       837       847       857       867       877       887       897       907       917       927       937       947       957       967       977       987       997      1007      1017      1027      1037      1047      1057      1067      1077       | -         -      1107      1117      1127      1137      1147      1157      1167      1177      1187      1197      1207      1217      1227   
                                                                                                                                                                                                                                                                                                                                                                                                                  594 598                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   1085                  1107

Chain N from PDB  Type:DNA  Length:21
                                                      
                4boc N  -26 ATGGGGTAACGACGCCAGACG    0
                                   -11        -1 
                                  -18|           
                                   -11

Chain R from PDB  Type:RNA  Length:9
                                          
                4boc R    1 GCGGCGCGC    9

Chain T from PDB  Type:DNA  Length:27
                                                            
                4boc T   -9 CGTCTGGCGTGCGCGCCGCTACCCCAT   17
                                     0        10

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

(no "SCOP Domain" information available for 4BOC)

(no "CATH Domain" information available for 4BOC)

(no "Pfam Domain" information available for 4BOC)

Asymmetric Unit(hide GO term definitions)

Chain A (RPOM_HUMAN | O00411)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
	GO:0003899	DNA-directed 5'-3' RNA polymerase activity	Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
	GO:0016779	nucleotidyltransferase activity	Catalysis of the transfer of a nucleotidyl group to a reactant.
	GO:0005515	protein binding	Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
	GO:0016740	transferase activity	Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
	GO:0007005	mitochondrion organization	A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a mitochondrion; includes mitochondrial morphogenesis and distribution, and replication of the mitochondrial genome as well as synthesis of new mitochondrial components.
	GO:0006390	transcription from mitochondrial promoter	The synthesis of RNA from a mitochondrial DNA template, usually by a specific mitochondrial RNA polymerase.
	GO:0006391	transcription initiation from mitochondrial promoter	A transcription initiation process that takes place at a promoter on the mitochondrial chromosome, and results in RNA synthesis by a mitochondrial RNA polymerase.
	GO:0006351	transcription, DNA-templated	The cellular synthesis of RNA on a template of DNA.
cellular component
	GO:0005759	mitochondrial matrix	The gel-like material, with considerable fine structure, that lies in the matrix space, or lumen, of a mitochondrion. It contains the enzymes of the tricarboxylic acid cycle and, in some organisms, the enzymes concerned with fatty acid oxidation.
	GO:0042645	mitochondrial nucleoid	The region of a mitochondrion to which the DNA is confined.
	GO:0005739	mitochondrion	A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration.

Asymmetric Unit
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 4boc)

	Sites
(no "Sites" information available for 4boc)

	Cis Peptide Bonds
		Ala A:290 - Gly A:291	[ RasMol ]
		Ala A:750 - Ala A:751	[ RasMol ]
		Gln A:1196 - Lys A:1197	[ RasMol ]
		Gln A:363 - Leu A:364	[ RasMol ]
		Gly A:557 - Ala A:558	[ RasMol ]
		Lys A:419 - Pro A:420	[ RasMol ]
		Pro A:742 - Glu A:743	[ RasMol ]
		Pro A:747 - His A:748	[ RasMol ]

Biological Unit
	Complete Structure
		Biological Unit 1	[ Jena3D ]

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Asym. Unit PNG format \| Biol. Unit 1 PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	4boc
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	RPOM_HUMAN \| O00411
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	2.7.7.6
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	RPOM_HUMAN \| O00411
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

UniProtKB/Swiss-Prot
	RPOM_HUMAN \| O00411	:	3spa

(no "Related Entries Specified in the PDB File" available for 4BOC)

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (8, 8)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (1, 1)

PROSITE Motifs (2, 2)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (12, 12)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File