3L1P - JenaLib

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:147
 aligned with PO5F1_MOUSE | P20263 from UniProtKB/Swiss-Prot  Length:352

    Alignment length:150
                                   140       150       160       170       180       190       200       210       220       230       240       250       260       270       280
          PO5F1_MOUSE   131 DMKALQKELEQFAKLLKQKRITLGYTQADVGLTLGVLFGKVFSQTTICRFEALQLSLKNMCKLRPLLEKWVEEADNNENLQEICKSETLVQARKRKRTSIENRVRWSLETMFLKCPKPSLQQITHIANQLGLEKDVVRVWFCNRRQKGKR 280
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh...hhhhhhhhhh...hhhhhhhhhhhhhhhhhhhh.hhhhhhh...---...........hhhhhhhhhh........hhhhhhhhhhhh..hhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                PROSITE (1) POU_3  PDB: A:1-75 UniProt: 131-205                                        ---------------HOMEOBOX_2  PDB: A:91-150 UniProt: 221-281                   PROSITE (1)
                PROSITE (2) ------------------POU_1        -----------POU_2         ---------------------------------------------------------------------HOMEOBOX_1              - PROSITE (2)
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 3l1p A   1 DMKALQKELEQFAKLLKQKRITLGYTQADVGLTLGVLFGKVFSQTTISRFEALQLSLKNMSKLRPLLEKWVEEADNNENLQEISKS---VQARKRKRTSIENRVRWSLETMFLKSPKPSLQQITHIANQLGLEKDVVRVWFSNRRQKGKR 150
                                    10        20        30        40        50        60        70        80     |  90       100       110       120       130       140       150
                                                                                                                86  90

Chain B from PDB  Type:PROTEIN  Length:145
 aligned with PO5F1_MOUSE | P20263 from UniProtKB/Swiss-Prot  Length:352

    Alignment length:149
                                   142       152       162       172       182       192       202       212       222       232       242       252       262       272         
          PO5F1_MOUSE   133 KALQKELEQFAKLLKQKRITLGYTQADVGLTLGVLFGKVFSQTTICRFEALQLSLKNMCKLRPLLEKWVEEADNNENLQEICKSETLVQARKRKRTSIENRVRWSLETMFLKCPKPSLQQITHIANQLGLEKDVVRVWFCNRRQKGKRS 281
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
           Pfam domains (1) Pou-3l1pB03 B:3-75                                                       ------------------Homeobox-3l1pB01 B:94-150                                - Pfam domains (1)
           Pfam domains (2) Pou-3l1pB04 B:3-75                                                       ------------------Homeobox-3l1pB02 B:94-150                                - Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh...hhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh.hhhhhh....----..........hhhhhhhhhhhh......hhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                PROSITE (1) POU_3  PDB: - UniProt: 131-205                                           ---------------HOMEOBOX_2  PDB: B:91-151 UniProt: 221-281                    PROSITE (1)
                PROSITE (2) ----------------POU_1        -----------POU_2         ---------------------------------------------------------------------HOMEOBOX_1              -- PROSITE (2)
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3l1p B   3 KALQKELEQFAKLLKQKRITLGYTQADVGLTLGVLFGKVFSQTTISRFEALQLSLKNMSKLRPLLEKWVEEADNNENLQEISKS----QARKRKRTSIENRVRWSLETMFLKSPKPSLQQITHIANQLGLEKDVVRVWFSNRRQKGKRS 151
                                    12        22        32        42        52        62        72        82   |    92       102       112       122       132       142         
                                                                                                              86   91

Chain M from PDB  Type:DNA  Length:23
                                                       
                 3l1p M   1 ATCCATTTGCCTTTCAAATGTGG  23
                                    10        20

Chain N from PDB  Type:DNA  Length:23
                                                       
                 3l1p N   1 TCCACATTTGAAAGGCAAATGGA  23
                                    10        20

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Asymmetric/Biological Unit(hide GO term definitions)

Chain A,B (PO5F1_MOUSE | P20263)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
	GO:0071837	HMG box domain binding	Interacting selectively and non-covalently with an HMG box domain, a protein domain that consists of three helices in an irregular array. HMG-box domains are found in one or more copies in HMG-box proteins, which form a large, diverse family involved in the regulation of DNA-dependent processes such as transcription, replication, and strand repair, all of which require the bending and unwinding of chromatin.
	GO:0070974	POU domain binding	Interacting selectively and non-covalently with a POU domain of a protein. The POU domain is a bipartite DNA binding domain composed of two subunits separated by a non-conserved region of 15-55 amino acids; it is found in several eukaryotic transcription factors.
	GO:0000978	RNA polymerase II core promoter proximal region sequence-specific DNA binding	Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
	GO:0001162	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding	Interacting selectively and non-covalently with an RNA polymerase II intronic DNA sequence that regulates the transcription of the transcript it is contained within.
	GO:0001105	RNA polymerase II transcription coactivator activity	Interacting selectively and non-covalently with an RNA polymerase II (RNAP II) regulatory transcription factor and also with the RNAP II basal transcription machinery in order to increase the frequency, rate or extent of transcription. Cofactors generally do not bind DNA, but rather mediate protein-protein interactions between activating transcription factors and the basal RNAP II transcription machinery.
	GO:0000981	RNA polymerase II transcription factor activity, sequence-specific DNA binding	Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription by RNA polymerase II. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
	GO:0031490	chromatin DNA binding	Interacting selectively and non-covalently with DNA that is assembled into chromatin.
	GO:0003682	chromatin binding	Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase.
	GO:0019955	cytokine binding	Interacting selectively and non-covalently with a cytokine, any of a group of proteins that function to control the survival, growth and differentiation of tissues and cells, and which have autocrine and paracrine activity.
	GO:0001158	enhancer sequence-specific DNA binding	Interacting selectively and non-covalently with a specific sequence of DNA that is part of an enhancer, a transcription regulatory region that is somewhat distal from the core promoter and which enhances transcription from that promoter.
	GO:0035198	miRNA binding	Interacting selectively and non-covalently with a microRNA, a 21-23 nucleotide RNA that is processed from a stem-loop RNA precursor (pre-miRNA) that is encoded within plant and animal genomes.
	GO:0005515	protein binding	Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
	GO:0046982	protein heterodimerization activity	Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
	GO:0043565	sequence-specific DNA binding	Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
	GO:0003714	transcription corepressor activity	Interacting selectively and non-covalently with a repressing transcription factor and also with the basal transcription machinery in order to stop, prevent, or reduce the frequency, rate or extent of transcription. Cofactors generally do not bind the template nucleic acid, but rather mediate protein-protein interactions between repressive transcription factors and the basal transcription machinery.
	GO:0003700	transcription factor activity, sequence-specific DNA binding	Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
	GO:0008134	transcription factor binding	Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
	GO:0044212	transcription regulatory region DNA binding	Interacting selectively and non-covalently with a DNA region that regulates the transcription of a region of DNA, which may be a gene, cistron, or operon. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
	GO:0000976	transcription regulatory region sequence-specific DNA binding	Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls transcription of that section of the DNA. The transcribed region might be described as a gene, cistron, or operon.
	GO:0001077	transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding	Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
	GO:0001227	transcriptional repressor activity, RNA polymerase II transcription regulatory region sequence-specific binding	Interacting selectively and non-covalently with a sequence of DNA that is in the regulatory region for RNA polymerase II (RNAP II) in order to stop, prevent, or reduce the frequency, rate or extent of transcription from an RNA polymerase II promoter.
	GO:0031625	ubiquitin protein ligase binding	Interacting selectively and non-covalently with a ubiquitin protein ligase enzyme, any of the E3 proteins.
biological process
	GO:0003130	BMP signaling pathway involved in heart induction	A series of molecular signals initiated by the binding of a member of the BMP (bone morphogenetic protein) family to a receptor on the surface of a target cell, which contributes to heart induction.
	GO:0001824	blastocyst development	The process whose specific outcome is the progression of the blastocyst over time, from its formation to the mature structure. The mammalian blastocyst is a hollow ball of cells containing two cell types, the inner cell mass and the trophectoderm.
	GO:0001832	blastocyst growth	An increase in size of a blastocyst due to expansion of the blastocoelic cavity cell shape changes and cell proliferation.
	GO:0060913	cardiac cell fate determination	The process involved in cardiac cell fate commitment. Once determination has taken place, a cell becomes committed to differentiate down a particular pathway regardless of its environment.
	GO:0045165	cell fate commitment	The commitment of cells to specific cell fates and their capacity to differentiate into particular kinds of cells. Positional information is established through protein signals that emanate from a localized source within a cell (the initial one-cell zygote) or within a developmental field.
	GO:0060795	cell fate commitment involved in formation of primary germ layer	The commitment of cells to specific cell fates of the endoderm, ectoderm, or mesoderm as a part of gastrulation.
	GO:0001712	ectodermal cell fate commitment	The cell differentiation process that results in commitment of a cell to become part of the ectoderm.
	GO:0001711	endodermal cell fate commitment	The cell differentiation process that results in commitment of a cell to become part of the endoderm.
	GO:0001714	endodermal cell fate specification	The cell fate determination process that results in a cell becoming capable of differentiating autonomously into an endoderm cell in an environment that is neutral with respect to the developmental pathway; upon specification, the cell fate can be reversed.
	GO:0030718	germ-line stem cell population maintenance	Any process by which an organism or tissue maintains a population of germ-line stem cells.
	GO:0042789	mRNA transcription from RNA polymerase II promoter	The cellular synthesis of messenger RNA (mRNA) from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter.
	GO:0001710	mesodermal cell fate commitment	The cell differentiation process that results in commitment of a cell to become part of the mesoderm.
	GO:0007275	multicellular organism development	The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult).
	GO:0045955	negative regulation of calcium ion-dependent exocytosis	Any process that stops, prevents, or reduces the frequency, rate or extent of calcium ion-dependent exocytosis.
	GO:0045596	negative regulation of cell differentiation	Any process that stops, prevents, or reduces the frequency, rate or extent of cell differentiation.
	GO:0010629	negative regulation of gene expression	Any process that decreases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
	GO:0060965	negative regulation of gene silencing by miRNA	Any process that decreases the rate, frequency, or extent of the downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: mRNA cleavage or translational repression.
	GO:0051898	negative regulation of protein kinase B signaling	Any process that stops, prevents, or reduces the frequency, rate or extent of protein kinase B signaling, a series of reactions mediated by the intracellular serine/threonine kinase protein kinase B.
	GO:0000122	negative regulation of transcription from RNA polymerase II promoter	Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter.
	GO:0045892	negative regulation of transcription, DNA-templated	Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
	GO:0060391	positive regulation of SMAD protein import into nucleus	Any process that increases the rate, frequency or extent of SMAD protein import into the nucleus, i.e. the directed movement of a SMAD proteins from the cytoplasm into the nucleus. Pathway-restricted SMAD proteins and common-partner SMAD proteins are involved in the transforming growth factor beta receptor signaling pathways.
	GO:0035413	positive regulation of catenin import into nucleus	Any process that increases the rate, frequency or extent of the directed movement of a catenin protein from the cytoplasm into the nucleus.
	GO:0010628	positive regulation of gene expression	Any process that increases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
	GO:0051897	positive regulation of protein kinase B signaling	Any process that activates or increases the frequency, rate or extent of protein kinase B signaling, a series of reactions mediated by the intracellular serine/threonine kinase protein kinase B.
	GO:0045944	positive regulation of transcription from RNA polymerase II promoter	Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
	GO:0045893	positive regulation of transcription, DNA-templated	Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
	GO:0009786	regulation of asymmetric cell division	Any process that modulates the frequency, rate or extent of asymmetric cell division.
	GO:0010468	regulation of gene expression	Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
	GO:0090081	regulation of heart induction by regulation of canonical Wnt signaling pathway	Any process that modulates the rate, frequency or extent of canonical Wnt signaling pathway that regulates heart induction. Canonical Wnt signaling pathway involved in heart induction is the series of molecular signals initiated by binding of Wnt protein to a frizzled family receptor on the surface of the target cell, followed by relaying of the signal via beta-catenin, and ending with a change in transcription of target genes.
	GO:0090308	regulation of methylation-dependent chromatin silencing	Any process that modulates the rate, frequency, or extent of the repression of transcription by methylation of DNA, leading to the formation of heterochromatin.
	GO:0006355	regulation of transcription, DNA-templated	Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
	GO:0034097	response to cytokine	Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cytokine stimulus.
	GO:0010033	response to organic substance	Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organic substance stimulus.
	GO:0032526	response to retinoic acid	Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus.
	GO:0035019	somatic stem cell population maintenance	Any process by which an organism retains a population of somatic stem cells, undifferentiated cells in the embryo or adult which can undergo unlimited division and give rise to cell types of the body other than those of the germ-line.
	GO:0048863	stem cell differentiation	The process in which a relatively unspecialized cell acquires specialized features of a stem cell. A stem cell is a cell that retains the ability to divide and proliferate throughout life to provide progenitor cells that can differentiate into specialized cells.
	GO:0019827	stem cell population maintenance	The process by which an organism or tissue maintains a population of stem cells of a single type. This can be achieved by a number of mechanisms: stem cell asymmetric division maintains stem cell numbers; stem cell symmetric division increases them; maintenance of a stem cell niche maintains the conditions for commitment to the stem cell fate for some types of stem cell; stem cells may arise de novo from other cell types.
	GO:0006366	transcription from RNA polymerase II promoter	The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
	GO:0006351	transcription, DNA-templated	The cellular synthesis of RNA on a template of DNA.
	GO:0001829	trophectodermal cell differentiation	The process in which a relatively unspecialized cell acquires the specialized features of a trophectoderm cell.
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
	GO:0005829	cytosol	The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
	GO:0000790	nuclear chromatin	The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome in the nucleus.
	GO:0044798	nuclear transcription factor complex	A protein complex, located in the nucleus, that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.
	GO:0005730	nucleolus	A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
	GO:0005654	nucleoplasm	That part of the nuclear content other than the chromosomes or the nucleolus.
	GO:0005634	nucleus	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
	GO:0005667	transcription factor complex	A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.
	GO:0017053	transcriptional repressor complex	A protein complex that possesses activity that prevents or downregulates transcription.

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (4, 4)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (5, 9)

Exons (0, 0)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (2, 4)

Gene Ontology (72, 72)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File