Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF SUPERFAMILY 2 HELICASE HEL308 IN COMPLEX WITH UNWOUND DNA
 
Authors :  K. Buettner, S. Nehring, K. P. Hopfner
Date :  19 Mar 07  (Deposition) - 12 Jun 07  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.00
Chains :  Asym./Biol. Unit :  A,X,Y
Keywords :  Protein-Dna Complex, Sf2 Helicase, Archaeal Helicase, Dna Repair, , Dna Binding Protein/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  K. Buttner, S. Nehring, K. P. Hopfner
Structural Basis For Dna Duplex Separation By A Superfamily-2 Helicase.
Nat. Struct. Mol. Biol. V. 14 647 2007
PubMed-ID: 17558417  |  Reference-DOI: 10.1038/NSMB1246
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 25-MER
    Chains: X
    Engineered: YES
    Synthetic: YES
 
Molecule 2 - 5'- D(*CP*TP*AP*GP*AP*GP*AP*CP*TP*AP*TP*CP*GP*AP*T)-3'
    Chains: Y
    Engineered: YES
    Synthetic: YES
 
Molecule 3 - AFUHEL308 HELICASE
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET-29
    Expression System Strain: ROSETTA (DE3)
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Organism Scientific: ARCHAEOGLOBUS FULGIDUS
    Organism Taxid: 2234

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit : AXY

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 2P6R)

(-) Sites  (0, 0)

(no "Site" information available for 2P6R)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2P6R)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2P6R)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2P6R)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 2P6R)

(-) Exons   (0, 0)

(no "Exon" information available for 2P6R)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:683
 aligned with HELS_ARCFU | P0DMI1 from UniProtKB/Swiss-Prot  Length:691

    Alignment length:686
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680      
           HELS_ARCFU     1 MKVEELAESISSYAVGILKEEGIEELFPPQAEAVEKVFSGKNLLLAMPTAAGKTLLAEMAMVREAIKGGKSLYVVPLRALAGEKYESFKKWEKIGLRIGISTGDYESRDEHLGDCDIIVTTSEKADSLIRNRASWIKAVSCLVVDEIHLLDSEKRGATLEILVTKMRRMNKALRVIGLSATAPNVTEIAEWLDADYYVSDWRPVPLVEGVLCEGTLELFDGAFSTSRRVKFEELVEECVAENGGVLVFESTRRGAEKTAVKLSAITAKYVENEGLEKAILEENEGEMSRKLAECVRKGAAFHHAGLLNGQRRVVEDAFRRGNIKVVVATPTLAAGVNLPARRVIVRSLYRFDGYSKRIKVSEYKQMAGRAGRPGMDERGEAIIIVGKRDREIAVKRYIFGEPERITSKLGVETHLRFHSLSIICDGYAKTLEELEDFFADTFFFKQNEISLSYELERVVRQLENWGMVVEDHHLAPTKLGSLVSRLYIDPLTGFIFHDVLSRMELSDIGALHLICRTPDMERLTVRKTDSWVEEEAFRLRKELSYYPSDFSVEYDWFLSEVKTALCLKDWIEEKDEDEICAKYGIAPGDLRRIVETAEWLSNAMNRIAEEVGNTSVSGLTERIKHGVKEELLELVRIRHIGRVRARKLYNAGIRNAEDIVRHREKVASLIGRGIAERVVEGISVKS 686
               SCOP domains d2p6ra3 A:1-202 Hel30   8 helicase                                                                                                                                                                        d2p6ra4 A:203-403 Hel308 helicase                                                                                                                                                                        d2p6ra1 A:404-488 Hel308 helicase                                                    d2p6ra2 A:489-686 Hel308 helicase                                                                                                                                                                      SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhh.---.....hhhhhhhhh....eeee..hhhhhhhhhhhhhhhhhhh...eeeee.hhhhhhhhhhhhh........eeee...............eeeeehhhhhhhhhh..hhhhhh.eeee.hhhhhhh..hhhhhhhhhhhhhhhh...eeeeee....hhhhhhhhh..eeee.......eeeeee...eeeeee..eeeeee.hhhhhhhhhhhh...eeee..hhhhhhhhhhhhhhhhhh.....hhhhhhhh...hhhhhhhhhhhhh...ee....hhhhhhhhhhhhhh....eeee.............eeee...eee...eee.hhhhhhhhhh..........eeeeee.hhhhhhhhhhh..............hhhhhhhhhhhhhhh....hhhhhhhhhhh..hhhhhh..hhhhhhhhhhhhhhh..eee...eeehhhhhhhhhh..hhhhhhhhhhhh.....hhhhhhhhhhhh...........hhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhhhh..hhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhh.hhhhhhhhh....hhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2p6r A   1 MKVEELAESISSYAVGILKEE---ELFPPQAEAVEKVFSGKNLLLAMPTAAGKTLLAEMAMVREAIKGGKSLYVVPLRALAGEKYESFKKWEKIGLRIGISTGDYESRDEHLGDCDIIVTTSEKADSLIRNRASWIKAVSCLVVDEIHLLDSEKRGATLEILVTKMRRMNKALRVIGLSATAPNVTEIAEWLDADYYVSDWRPVPLVEGVLCEGTLELFDGAFSTSRRVKFEELVEECVAENGGVLVFESTRRGAEKTAVKLSAITAKYVENEGLEKAILEENEGEMSRKLAECVRKGAAFHHAGLLNGQRRVVEDAFRRGNIKVVVATPTLAAGVNLPARRVIVRSLYRFDGYSKRIKVSEYKQMAGRAGRPGMDERGEAIIIVGKRDREIAVKRYIFGEPERITSKLGVETHLRFHSLSIICDGYAKTLEELEDFFADTFFFKQNEISLSYELERVVRQLENWGMVVEAAHLAPTKLGSLVSRLYIDPLTGFIFHDVLSRMELSDIGALHLICRTPDMERLTVRKTDSWVEEEAFRLRKELSYYPSDFSVEYDWFLSEVKTALCLKDWIEEKDEDEICAKYGIAPGDLRRIVETAEWLSNAMNRIAEEVGNTSVSGLTERIKHGVKEELLELVRIRHIGRVRARKLYNAGIRNAEDIVRHREKVASLIGRGIAERVVEGISVKS 686
                                    10        20|   |   30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680      
                                               21  25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     


Chain X from PDB  Type:DNA  Length:25
                                                         
                 2p6r X   1 ATCGATAGTCTCTAGACAGCATGTC  25
                                    10        20     


Chain Y from PDB  Type:DNA  Length:15
                                               
                 2p6r Y  11 CTAGAGACTATCGAT  25
                                    20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 4)

Asymmetric/Biological Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 2P6R)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2P6R)

(-) Gene Ontology  (9, 9)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (HELS_ARCFU | P0DMI1)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0004386    helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0016818    hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides    Catalysis of the hydrolysis of any acid anhydride which contains phosphorus.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0006281    DNA repair    The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 2p6r)
 
  Sites
(no "Sites" information available for 2p6r)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2p6r)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2p6r
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  HELS_ARCFU | P0DMI1
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  HELS_ARCFU | P0DMI1
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        HELS_ARCFU | P0DMI1: 2p6u

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 2P6R)