Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
(-)Biological Unit 3
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)
Image Biological Unit 3
Biological Unit 3  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF PYROCOCCUS HORIKOSHII ARGINYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(ARG)
 
Authors :  M. Konno, T. Sumida, E. Uchikawa, Y. Mori, T. Yanagisawa, S. Sekine, S. Yokoyama
Date :  16 Oct 08  (Deposition) - 18 Aug 09  (Release) - 18 Aug 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.30
Chains :  Asym. Unit :  A,B
Biol. Unit 1:  A  (1x)
Biol. Unit 2:  B  (1x)
Biol. Unit 3:  A,B  (1x)
Keywords :  Rrs/Trna(Arg), Aminoacyl-Trna Synthetase, Atp-Binding, Cytoplasm, Ligase, Nucleotide-Binding, Protein Biosynthesis, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  M. Konno, T. Sumida, E. Uchikawa, Y. Mori, T. Yanagisawa, S. Sekine, S. Yokoyama
Modeling Of Trna-Assisted Mechanism Of Arg Activation Based On A Structure Of Arg-Trna Synthetase, Trna, And An Atp Analog (Anp)
Febs J. V. 276 4763 2009
PubMed-ID: 19656186  |  Reference-DOI: 10.1111/J.1742-4658.2009.07178.X
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - ARGINYL-TRNA SYNTHETASE
    ChainsA
    EC Number6.1.1.19
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPET28C
    Expression System StrainBL21(DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    GeneARGS, PH1478
    Organism ScientificPYROCOCCUS HORIKOSHII
    Organism Taxid53953
    SynonymARGININE--TRNA LIGASE, ARGRS
 
Molecule 2 - TRNA-ARG
    ChainsB
    EngineeredYES
    Other DetailsTHIS TRNA OCCURS FROM PYROCOCCUS HORIKOSHII, IN VITRO TRANSCRIPTION
    SyntheticYES

 Structural Features

(-) Chains, Units

  12
Asymmetric Unit AB
Biological Unit 1 (1x)A 
Biological Unit 2 (1x) B
Biological Unit 3 (1x)AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 2ZUF)

(-) Sites  (0, 0)

(no "Site" information available for 2ZUF)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2ZUF)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2ZUF)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2ZUF)

(-) PROSITE Motifs  (1, 1)

Asymmetric Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYR_PYRHO130-139  1A:130-139
Biological Unit 1 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYR_PYRHO130-139  1A:130-139
Biological Unit 2 (, 0)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYR_PYRHO130-139  0-
Biological Unit 3 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYR_PYRHO130-139  1A:130-139

(-) Exons   (0, 0)

(no "Exon" information available for 2ZUF)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:628
 aligned with SYR_PYRHO | O59147 from UniProtKB/Swiss-Prot  Length:629

    Alignment length:628
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621        
           SYR_PYRHO      2 LMEIRESVKERIEEIIKEIAPQWEGEIELKETPDPKLGDFGTPIAFKLAKLLKRPPIEIAEKIVEKLKLNLPEGIKDVKAVNGYINVFIDYPHFARILINDILAKGDRFGSSEIGKGKKVIVEHTSVNPTKPLHMGHARNAILGDVMARILRFLGYEVEVQNYIDDLGIQFAQVYWGYLRLKEEFERIMNELRERGLKDNPIDHALGLLYVEVNRRLEDNPELENEIRDIMKKLESGELYGRKLAEEVVRAQMVTTYKLGVKYDLLVWESDIVRRKLFEIALELLSKNENFYIPSDGKYRGAFVMDLRKLFPDMKNPILVLRRSDGTATYTGKDIAYHLWKFGKIDVDLLYKEWDSTTWTTAPDGKSMPNKFGNANIVINVIGAEQKHPQLAIKYALQLLGFEDAAANLYHLAYEHVERPEGKFSGRKGTWVGFTVDEVIQEAVKRARELIEEKNPALSDEEKAEVAEKVGIGAIRYNLIKYSPDKKIIFRWEDVLNFEGESAPYIQYAHARCSSILRKAEEEGIKVDPETLFKNADFTKLSERERELVIMLSKFPRIVEQAGKDVKPHLIAWFANELASLFNKFYMDHPVLKAEEGVREARLLLVMAVEQVLKNALYLMGIEAPERM  629
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------2zufA02 A:117-510 Tyrosyl-Transfer RNA Synthetase , subunit E, domain 1                                                                                                                                                                                                                                                                                                                                   2zufA03 A:511-629 Isoleucyl-tRNA Synthetase; Domain 1                                                                   CATH domains
           Pfam domains (1) --Arg_tRNA_synt_N-2zufA04 A:4-90                                                         -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------tRNA-synt_1d-2zufA02 A:368-493                                                                                                -------------DALR_1-2zufA01 A:507-629                                                                                                    Pfam domains (1)
           Pfam domains (2) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------tRNA-synt_1d-2zufA03 A:368-493                                                                                                ---------------------------------------------------------------------------------------------------------------------------------------- Pfam domains (2)
         Sec.struct. author ..hhhhhhhhhhhhhhhhhh.........ee..hhhhh.eeehhhhhhhhhh..hhhhhhhhhhhhhhh.....eeeeeee..eeeeeehhhhhhhhhhhhhhhhhhhh.........eeeee..........hhhhhhhhhhhhhhhhhhhhh..eeeeeeee...hhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.....eeeehhhhhhhhhhhhhhhhhhh...ee..........eeee...........eeeee......hhhhhhhhhhhhhh.......eeee.....eee....ee.........eeeeeee..hhhhhhhhhhhhhhh.hhhhhhheeeeee..ee................hhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhh......ee..hhhhhh....hhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhh........ Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------AA_TRNA_LI---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                2zuf A    2 LMEIRESVKERIEEIIKEIAPQWEGEIELKETPDPKLGDFGTPIAFKLAKLLKRPPIEIAEKIVEKLKLNLPEGIKDVKAVNGYINVFIDYPHFARILINDILAKGDRFGSSEIGKGKKVIVEHTSVNPTKPLHMGHARNAILGDVMARILRFLGYEVEVQNYIDDLGIQFAQVYWGYLRLKEEFERIMNELRERGLKDNPIDHALGLLYVEVNRRLEDNPELENEIRDIMKKLESGELYGRKLAEEVVRAQMVTTYKLGVKYDLLVWESDIVRRKLFEIALELLSKNENFYIPSDGKYRGAFVMDLRKLFPDMKNPILVLRRSDGTATYTGKDIAYHLWKFGKIDVDLLYKEWDSTTWTTAPDGKSMPNKFGNANIVINVIGAEQKHPQLAIKYALQLLGFEDAAANLYHLAYEHVERPEGKFSGRKGTWVGFTVDEVIQEAVKRARELIEEKNPALSDEEKAEVAEKVGIGAIRYNLIKYSPDKKIIFRWEDVLNFEGESAPYIQYAHARCSSILRKAEEEGIKVDPETLFKNADFTKLSERERELVIMLSKFPRIVEQAGKDVKPHLIAWFANELASLFNKFYMDHPVLKAEEGVREARLLLVMAVEQVLKNALYLMGIEAPERM  629
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621        

Chain B from PDB  Type:RNA  Length:76
                                                                                                             
                2zuf B  901 GGACCGGUAGCCUAGCCAGGACAGGGCGGCGGCCUCCUAAGCCGCAGGUCCGGGGUUCAAAUCCCCGCCGGUCCGC  974
                                   910       919 |     928       938       948       958       968      
                                          917A   |                                                      
                                              920A                                                      

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 2ZUF)

(-) CATH Domains  (2, 2)

Asymmetric Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (3, 4)

Asymmetric Unit
(-)
Clan: DALR (5)
(-)
Clan: HUP (230)

(-) Gene Ontology  (9, 9)

Asymmetric Unit(hide GO term definitions)
Chain A   (SYR_PYRHO | O59147)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0004814    arginine-tRNA ligase activity    Catalysis of the reaction: ATP + L-arginine + tRNA(Arg) = AMP + diphosphate + L-arginyl-tRNA(Arg).
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0006420    arginyl-tRNA aminoacylation    The process of coupling arginine to arginyl-tRNA, catalyzed by arginyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 2zuf)
 
  Sites
(no "Sites" information available for 2zuf)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2zuf)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]
    Biological Unit 3  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2zuf
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYR_PYRHO | O59147
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.19
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  SYR_PYRHO | O59147
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYR_PYRHO | O591472zue

(-) Related Entries Specified in the PDB File

2zue THE SAME PROTEIN COMPLEXED WITH TRNA(ARG) AND AMP-PNP