1X1L - JenaLib

Title :   INTERACTION OF ERA,A GTPASE PROTEIN, WITH THE 3'MINOR DOMAIN OF THE 16S RRNA WITHIN THE THERMUS THERMOPHILUS 30S SUBUNIT.

Authors :   M. R. Sharma, C. Barat, R. K. Agrawal

Date :   06 Apr 05 (Deposition) - 17 May 05 (Release) - 24 Feb 09 (Revision)

Method :   ELECTRON MICROSCOPY

Resolution :   13.50

Chains :   Asym./Biol. Unit : A,X

Keywords :   Interaction Of Era Protein With The 3'Minor Domain Of 16S Rrna, Structural Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   M. R. Sharma, C. Barat, D. N. Wilson, T. M. Booth, M. Kawazoe, C. Hori-Takemoto, M. Shirouzu, S. Yokoyama, P. Fucini, R. K. Agrawal
Interaction Of Era With The 30S Ribosomal Subunit Implications For 30S Subunit Assembly
Mol. Cell V. 18 319 2005
PubMed-ID: 15866174 | Reference-DOI: 10.1016/J.MOLCEL.2005.03.028
(for further references see the PDB file header)

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (2, 2)

Exons (0, 0)

Sequences/Alignments

Asymmetric/Biological Unit

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:130
                                                                                                                                                                  
                 1x1l A 400 CGCCCGUCACGCCAUGGGAGCGGGCUCUACCCGAAGUCGCCGGGAGCCUACGGGCAGGCGCCGAGGGUAGGGCCCGUGACUGGGGCGAAGUCGUAACAAGGUAGCUGUACCGGAAGGUGCGGCUGGAUCA 534
                                   409       419       429       439   ||  451   ||  464       474       484       494       504       514       524       534
                                                                     443|      455|                                                                           
                                                                      446       459

Chain X from PDB  Type:PROTEIN  Length:292
 aligned with ERA_ECOLI | P06616 from UniProtKB/Swiss-Prot  Length:301

    Alignment length:292
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293  
            ERA_ECOLI     4 DKSYCGFIAIVGRPNVGKSTLLNKLLGQKISITSRKAQTTRHRIVGIHTEGAYQAIYVDTPGLHMEEKRAINRLMNKAASSSIGDVELVIFVVEGTRWTPDDEMVLNKLREGKAPVILAVNKVDNVQEKADLLPHLQFLASQMNFLDIVPISAETGLNVDTIAAIVRKHLPEATHHFPEDYITDRSQRFMASEIIREKLMRFLGAELPYSVTVEIERFVSNERGGYDINGLILVEREGQKKMVIGNKGAKIKTIGIEARKDMQEMFEAPVHLELWVKVKSGWADDERALRSL 295
               SCOP domains d1x1lx1 X:4-182 GTPase Era, N-terminal domain                                                                                                                                      d1x1lx2 X:183-295 GTPase Era C-terminal domain                                                                    SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .................................................................................................................................................................................................................................................................................................... Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---G_ERA  PDB: X:7-175 UniProt: 7-175                                                                                                                                       ------------------------------KH_TYPE_2  PDB: X:206-283 UniProt: 206-283                                    ------------ PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1x1l X   4 DKSYCGFIAIVGRPNVGKSTLLNKLLGQKISITSRKAQTTRHRIVGIHTEGAYQAIYVDTPGLHMEEKRAINRLMNKAASSSIGDVELVIFVVEGTRWTPDDEMVLNKLREGKAPVILAVNKVDNVQEKADLLPHLQFLASQMNFLDIVPISAETGLNVDTIAAIVRKHLPEATHHFPEDYITDRSQRFMASEIIREKLMRFLGAELPYSVTVEIERFVSNERGGYDINGLILVEREGQKKMVIGNKGAKIKTIGIEARKDMQEMFEAPVHLELWVKVKSGWADDERALRSL 295
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (2, 2)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (16, 29)

Asymmetric/Biological Unit(hide GO term definitions)

Chain X (ERA_ECOLI | P06616)

molecular function
	GO:0005525	GTP binding	Interacting selectively and non-covalently with GTP, guanosine triphosphate.
	GO:0003924	GTPase activity	Catalysis of the reaction: GTP + H2O = GDP + phosphate.
	GO:0003723	RNA binding	Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
	GO:0000166	nucleotide binding	Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
	GO:0019843	rRNA binding	Interacting selectively and non-covalently with ribosomal RNA.
	GO:0043024	ribosomal small subunit binding	Interacting selectively and non-covalently with any part of the small ribosomal subunit.
	GO:0070181	small ribosomal subunit rRNA binding	Interacting selectively and non-covalently with the small ribosomal subunit RNA (SSU rRNA), a constituent of the small ribosomal subunit. In S. cerevisiae, this is the 18S rRNA.
biological process
	GO:0006468	protein phosphorylation	The process of introducing a phosphate group on to a protein.
	GO:0042274	ribosomal small subunit biogenesis	A cellular process that results in the biosynthesis of constituent macromolecules, assembly, and arrangement of constituent parts of a small ribosomal subunit; includes transport to the sites of protein synthesis.
	GO:0042254	ribosome biogenesis	A cellular process that results in the biosynthesis of constituent macromolecules, assembly, and arrangement of constituent parts of ribosome subunits; includes transport to the sites of protein synthesis.
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
	GO:0005829	cytosol	The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes.
	GO:0005622	intracellular	The living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm.
	GO:0016020	membrane	A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.
	GO:0005886	plasma membrane	The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins.

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	1x1l
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	ERA_ECOLI \| P06616
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt
	ERA_THET8 \| Q5SM23
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Description