1FJE - JenaLib

Title :   SOLUTION STRUCTURE OF NUCLEOLIN RBD12 IN COMPLEX WITH SNRE RNA

Authors :   F. H. T. Allain, P. Bouvet, T. Dieckmann, J. Feigon

Date :   08 Aug 00 (Deposition) - 03 Jan 01 (Release) - 24 Feb 09 (Revision)

Method :   SOLUTION NMR

Resolution :   NOT APPLICABLE

Chains :   NMR Structure  : A,B  (19x)

Keywords :   Rnp, Rbd, Rrm, Rna Binding Domain, Rna-Protein Complex, Nucleolus, Structural Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   F. H. Allain, P. Bouvet, T. Dieckmann, J. Feigon
Molecular Basis Of Sequence-Specific Recognition Of Pre-Ribosomal Rna By Nucleolin.
Embo J. V. 19 6870 2000
PubMed-ID: 11118222 | Reference-DOI: 10.1093/EMBOJ/19.24.6870
(for further references see the PDB file header)

Compounds

Molecule 1 - SNRE RNA
	Chains	:	A
	Engineered	:	YES
	Other Details	:	IN VITRO SELECTED RNA
	Other Details - Source	:	IN VITRO TRANSCRIPTION BY T7 RNA POLYMERASE
	Synthetic	:	YES

Molecule 2 - NUCLEOLIN RBD12
	Chains	:	B
	Engineered	:	YES
	Expression System	:	ESCHERICHIA COLI
	Expression System Plasmid	:	PET15-B
	Expression System Taxid	:	562
	Expression System Vector Type	:	PLASMID
	Fragment	:	TWO N-TERMINAL RBD DOMAINS
	Organism Common	:	GOLDEN HAMSTER
	Organism Scientific	:	MESOCRICETUS AURATUS
	Organism Taxid	:	10036
	Synonym	:	PROTEIN C23

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (0, 0)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (1, 2)

Exons (0, 0)

Sequences/Alignments

NMR Structure

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:RNA  Length:22
                                                      
                 1fje A   1 GGCCGAAAUCCCGAAGUAGGCC  22
                                    10        20

Chain B from PDB  Type:PROTEIN  Length:175
 aligned with NUCL_MESAU | P08199 from UniProtKB/Swiss-Prot  Length:714

    Alignment length:175
                                   304       314       324       334       344       354       364       374       384       394       404       414       424       434       444       454       464     
           NUCL_MESAU   295 KKQKVEGSESTTPFNLFIGNLNPNKSVAELKVAISEPFAKNDLAVVDVRTGTNRKFGYVDFESAEDLEKALELTGLKVFGNEIKLEKPKGRDSKKVRAARTLLAKNLSFNITEDELKEVFEDALEIRLVSQDGKSKGIAYIEFKSEADAEKNLEEKQGAEIDGRSVSLYYTGEKG 469
               SCOP domains d1fjeb1 B:1-91 Nucleolin                                                                   d1fjeb2 B:92-175 Nucleolin                                                           SCOP domains
               CATH domains ----------1fjeB01 B:11-91  [code=3.30.70.330, no name defined]                             1fjeB02 B:92-175  [code=3.30.70.330, no name defined]                                CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .............eeeeee......hhhhhhhhhhhhhhhhh....eeeee....eeeeee.hhhhhhhhhhh..eee..eeeeee.........hhhh.eeeee......hhhhhhhhh....eeeee........eeeee..hhhhhhhhhhhhheeee..eeeeeee..... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------RRM  PDB: B:14-90 UniProt: 308-384                                           ---------RRM  PDB: B:100-173 UniProt: 394-467                                      -- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1fje B   1 GSHMVEGSESTTPFNLFIGNLNPNKSVAELKVAISELFAKNDLAVVDVRTGTNRKFGYVDFESAEDLEKALELTGLKVFGNEIKLEKPKGRDSKKVRAARTLLAKNLSFNITEDELKEVFEDALEIRLVSQDGKSKGIAYIEFKSEADAEKNLEEKQGAEIDGRSVSLYYTGEKG 175
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

Classification and Annotation

SCOP Domains (1, 2)

CATH Domains (1, 2)

Pfam Domains (0, 0)

Gene Ontology (9, 9)

NMR Structure(hide GO term definitions)

Chain B (NUCL_MESAU | P08199)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
	GO:0003723	RNA binding	Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
	GO:0003676	nucleic acid binding	Interacting selectively and non-covalently with any nucleic acid.
	GO:0000166	nucleotide binding	Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
	GO:0042162	telomeric DNA binding	Interacting selectively and non-covalently with a telomere, a specific structure at the end of a linear chromosome required for the integrity and maintenance of the end.
cellular component
	GO:0005737	cytoplasm	All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
	GO:0030529	intracellular ribonucleoprotein complex	An intracellular macromolecular complex containing both protein and RNA molecules.
	GO:0005730	nucleolus	A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
	GO:0005634	nucleus	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

Visualization

Interactive Views

NMR Structure
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1fje)

	Sites
(no "Sites" information available for 1fje)

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1fje)

Still Images

Databases and Analysis Tools

Databases

Access by PDB/NDB ID
	1fje
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	NUCL_MESAU \| P08199
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Analysis Tools

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	NUCL_MESAU \| P08199
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

Description