Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  5S RRNA STRUCTURE FITTED TO A CRYO-ELECTRON MICROSCOPIC MAP AT 7.5 ANGSTROMS RESOLUTION
 
Authors :  R. Brimacombe, F. Mueller
Date :  28 Jul 99  (Deposition) - 10 Apr 00  (Release) - 24 Feb 09  (Revision)
Method :  ELECTRON MICROSCOPY
Resolution :  7.50
Chains :  Asym./Biol. Unit :  C
Keywords :  5S Rrna, 23S Rrna, Ribosome, Large Ribosomal Subunit, Protein Biosynthesis, Ribonucleic Acid, Em-Reconstruction, Atomic Structure, 3D Arrangement, Fitting (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  F. Mueller, I. Sommer, P. Baranov, R. Matadeen, M. Stoldt, J. Wohnert, M. Gorlach, M. Van Heel, R. Brimacombe
The 3D Arrangement Of The 23 S And 5 S Rrna In The Escherichia Coli 50 S Ribosomal Subunit Based On A Cryo-Electron Microscopic Reconstruction At 7. 5 A Resolution.
J. Mol. Biol. V. 298 35 2000
PubMed-ID: 10756104  |  Reference-DOI: 10.1006/JMBI.2000.3635
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 5S RIBOSOMAL RNA
    Cellular LocationCYTOPLASM
    ChainsC
    Organism ScientificESCHERICHIA COLI
    Organism Taxid562
    Other DetailsTHIRD OF THE 3 RRNA CHAINS OF THE RIBOSOME
    Synonym5S RRNA

 Structural Features

(-) Chains, Units

  1
Asymmetric/Biological Unit C

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1C2X)

(-) Sites  (0, 0)

(no "Site" information available for 1C2X)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1C2X)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1C2X)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1C2X)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1C2X)

(-) Exons   (0, 0)

(no "Exon" information available for 1C2X)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain C from PDB  Type:RNA  Length:120
                                                                                                                                                        
                 1c2x C   1 UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU 120
                                    10        20        30        40        50        60        70        80        90       100       110       120

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 1C2X)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1C2X)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1C2X)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 1C2X)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1c2x)
 
  Sites
(no "Sites" information available for 1c2x)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1c2x)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1c2x
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1C2X)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1C2X)