Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  STRUCTURE OF RECG BOUND TO THREE-WAY DNA JUNCTION
 
Authors :  M. R. Singleton, S. Scaife, D. B. Wigley
Date :  11 Sep 01  (Deposition) - 03 Oct 01  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.24
Chains :  Asym./Biol. Unit :  A,X,Y,Z
Keywords :  Helicase, Replication Restart (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  M. R. Singleton, S. Scaife, D. B. Wigley
Structural Analysis Of Dna Replication Fork Reversal By Recg
Cell(Cambridge, Mass. ) V. 107 79 2001
PubMed-ID: 11595187  |  Reference-DOI: 10.1016/S0092-8674(01)00501-3

(-) Compounds

Molecule 1 - RECG
    Chains: A
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PET28
    Expression System Strain: B834
    Expression System Taxid: 562
    Organism Scientific: THERMOTOGA MARITIMA
    Organism Taxid: 2336
 
Molecule 2 - DNA (5'-(*CP*AP*GP*CP*TP*CP*CP*AP*TP*GP*AP*TP* CP*AP*TP*TP*GP*GP*CP*A)-3')
    Chains: X
    Synthetic: YES
 
Molecule 3 - DNA (5'-(*GP*CP*AP*GP*TP*GP*CP*TP*CP*GP*CP*AP* TP*GP*GP*AP*GP*CP*TP*G)-3')
    Chains: Y
    Synthetic: YES
 
Molecule 4 - DNA (5'-(*GP*AP*GP*CP*AP*CP*TP*GP*C)-3')
    Chains: Z
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : AXYZ

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 2)

Asymmetric/Biological Unit (2, 2)
No.NameCountTypeFull Name
1ADP1Ligand/IonADENOSINE-5'-DIPHOSPHATE
2MG1Ligand/IonMAGNESIUM ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWARETHR A:403 , MET A:522 , ADP A:1756BINDING SITE FOR RESIDUE MG A1757
2AC2SOFTWAREPHE A:367 , LEU A:369 , GLN A:373 , GLY A:399 , SER A:400 , GLY A:401 , LYS A:402 , THR A:403 , VAL A:404 , ARG A:436 , MG A:1757BINDING SITE FOR RESIDUE ADP A1756

(-) SS Bonds  (1, 1)

Asymmetric/Biological Unit
No.Residues
1A:106 -A:282

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1GM5)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1GM5)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1GM5)

(-) Exons   (0, 0)

(no "Exon" information available for 1GM5)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:729
 aligned with Q9WY48_THEMA | Q9WY48 from UniProtKB/TrEMBL  Length:780

    Alignment length:749
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496       506       516       526       536       546       556       566       576       586       596       606       616       626       636       646       656       666       676       686       696       706       716       726       736       746         
         Q9WY48_THEMA     7 FTSSLFLWGEALPTLLEEFLNEVEKMLKNQVNTRRIHQLLKELDDPLLENKDLEEKLQAFLDYVKEIPNLPEARKRYRIQKSLEMIEKLRSWFLIDYLECSGEEVDLSTDIQYAKGVGPNRKKKLKKLGIETLRDLLEFFPRDYEDRRKIFKLNDLLPGEKVTTQGKIVSVETKKFQNMNILTAVLSDGLVHVPLKWFNQDYLQTYLKQLTGKEVFVTGTVKSNAYTGQYEIHNAEVTPKEGEYVRRILPIYRLTSGISQKQMRKIFEENIPSLCCSLKETLPERILEKRKLLGVKDAYYGMHFPKTFYHLEKARERLAYEELFVLQLAFQKIRKEREKHGGIPKKIEGKLAEEFIKSLPFKLTNAQKRAHQEIRNDMISEKPMNRLLQGDVGSGKTVVAQLAILDNYEAGFQTAFMVPTSILAIQHYRRTVESFSKFNIHVALLIGATTPSEKEKIKSGLRNGQIDVVIGTHALIQEDVHFKNLGLVIIDEQHRFGVKQREALMNKGKMVDTLVMSATPIPRSMALAFYGDLDVTVIDEMPPGRKEVQTMLVPMDRVNEVYEFVRQEVMRGGQAFIVYPLIEESDKLNVKSAVEMYEYLSKEVFPEFKLGLMHGRLSQEEKDRVMLEFAEGRYDILVSTTVIEVGIDVPRANVMVIENPERFGLAQLHQLRGRVGRGGQEAYCFLVVGDVGEEAMERLRFFTLNTDGFKIAEYDLKTRGPGEFFGVKQHGLSGFKVADLYRDLKLLEW 755
               SCOP domains d1gm5a1 A:7-105 RecG, N-terminal domain                                                            d1gm5a2 A:106-285 RecG wedge domain                                                                                                                                                 d1gm5a3 A:286-549 RecG helicase domain                                                                                                                                                                                                                                  d1gm5a4 A:550-755 RecG helicase domain                                                                                                                                                                         SCOP domains
               CATH domains 1gm5A01 A:7-101 RecG, N-terminal domain                                                        ---------------------------------------------------1gm5A03 A:153-254 Nucleic acid-binding proteins                                                       ----------------------------------------------------------------------------------------------1gm5A04 A:349-552 P-loop containing nucleotide triphosphate hydrolases                                                                                                                                      1gm5A05 A:553-725 P-loop containing         nucleotide trip   hosphate hydrolases                                                                                            ----    ---------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhh....hhhhhhhhhhhhhh......hhhhhhhhh.hhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhh.....hhhhh.....eee.................eeee.....eeee....eeeeeee......eeeee.....hhhhhhh.....eeee.............ee..eee..........eee.......hhhhhhhhhhhhhhhhhhh.....hhhhhhhhh...hhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhh....hhhhhhhhhhhhhhhhh......eee.....hhhhhhhhhhhhhhhhh..eeee..hhhhhhhhhhhhhhhhh.....eee.....hhhhhhhhhhhhhh....eeee..hhhhhh.......eeeee.....-----...........eeeee....hhhhhhhhh.....eee..........ee......hhhhhhhhhhhhh.............--------hhhhhhhhhhhhh..---.............hhhhhhhhh.......................eee.........hhhhhhhhh........eee......hhhhhhhhhhhhh...hhhhhhhhhhh.....----.........hhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1gm5 A   7 FTSSLFLWGEALPTLLEEFLNEVEKMLKNQVNTRRIHQLLKELDDPLLENKDLEEKLQAFLDYVKEIPNLPEARKRYRIQKSLEMIEKLRSWFLIDYLECSGEEVDLSTDIQYAKGVGPNRKKKLKKLGIETLRDLLEFFPRDYEDRRKIFKLNDLLPGEKVTTQGKIVSVETKKFQNMNILTAVLSDGLVHVPLKWFNQDYLQTYLKQLTGKEVFVTGTVKSNAYTGQYEIHNAEVTPKEGEYVRRILPIYRLTSGISQKQMRKIFEENIPSLCCSLKETLPERILEKRKLLGVKDAYYGMHFPKTFYHLEKARERLAYEELFVLQLAFQKIRKEREKHGGIPKKIEGKLAEEFIKSLPFKLTNAQKRAHQEIRNDMISEKPMNRLLQGDVGSGKTVVAQLAILDNYEAGFQTAFMVPTSILAIQHYRRTVESFSKFNIHVALLIGATTPSEKEKIKSGLRNGQIDVVIGTHALIQEDVHFKNLGLVIIDEQHRF-----EALMNKGKMVDTLVMSATPIPRSMALAFYGDLDVTVIDEMPPGRKEVQTMLVPMDRVNEVYEFVRQEVMRGGQAFIVYPLI--------KSAVEMYEYLSKEVF---KLGLMHGRLSQEEKDRVMLEFAEGRYDILVSTTVIEVGIDVPRANVMVIENPERFGLAQLHQLRGRVGRGGQEAYCFLVVGDVGEEAMERLRFFTLNTDGFKIAEYDLKTRGPGE----KQHGLSGFKVADLYRDLKLLEW 755
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496     |   - |     516       526       536       546       556       566       576       586 |       -|      606    |  616       626       636       646       656       666       676       686       696       706       716       726  |    736       746         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         502   508                                                                             588      597           611 615                                                                                                               729  734                     


Chain X from PDB  Type:DNA  Length:12
                                            
                 1gm5 X   1 CAGCTCCATGAT  12
                                    10  


Chain Y from PDB  Type:DNA  Length:20
                                                    
                 1gm5 Y   1 GCAGTGCTCGCATGGAGCTG  20
                                    10        20


Chain Z from PDB  Type:DNA  Length:9
                                         
                 1gm5 Z   1 GAGCACTGC   9
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 4)

Asymmetric/Biological Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: All beta proteins (24004)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (3, 4)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Alpha (13335)
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1GM5)

(-) Gene Ontology  (12, 12)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (Q9WY48_THEMA | Q9WY48)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004003    ATP-dependent DNA helicase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of the DNA helix.
    GO:0004004    ATP-dependent RNA helicase activity    Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of an RNA helix.
    GO:0004386    helicase activity    Catalysis of the reaction: NTP + H2O = NDP + phosphate, to drive the unwinding of a DNA or RNA helix.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
biological process
    GO:0032508    DNA duplex unwinding    The process in which interchain hydrogen bonds between two strands of DNA are broken or 'melted', generating a region of unpaired single strands.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Intrachromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0006281    DNA repair    The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
    GO:0010501    RNA secondary structure unwinding    The process in which a secondary structure of RNA are broken or 'melted'.
    GO:0006974    cellular response to DNA damage stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ADP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1gm5)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1gm5
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  Q9WY48_THEMA | Q9WY48
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  Q9WY48_THEMA | Q9WY48
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1GM5)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1GM5)