Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - manually
(-)NMR Structure - model 1
(-)NMR Structure - model 1, sites
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - manually
NMR Structure - manually  (Jmol Viewer)
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - model 1, sites
NMR Structure - model 1, sites  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  NMR STUDY OF TRP REPRESSOR-MTR OPERATOR DNA COMPLEX
 
Authors :  G. P. Zhou, L. Brocchieri, O. Jardetzky
Date :  30 May 99  (Deposition) - 16 Sep 03  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A,B,E,F  (15x)
Keywords :  Transcription Regulation, Repressor, Dna-Binding, Trp, Peptide, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  L. Brocchieri, G. P. Zhou, O. Jardetzky
Allostery And Induced Fit, Nmr And Molecular Modeling Study Of The Trp-Repressor - Mtr Dna Complex
Structures And Mechanisms, V. 827 340 2002 Acs Symposium Series
PubMed: search
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - TRP OPERON REPRESSOR
    Chains: A, B
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Strain: CY15070,CY17071
    Expression System Taxid: 562
    Organism Scientific: ESCHERICHIA COLI
    Organism Taxid: 562
 
Molecule 2 - 5'- D(*TP*GP*TP*AP*CP*TP*CP*GP*TP*GP*TP*AP*CP*TP*GP*GP*TP*AP*CP *A)-3'
    Chains: E
    Engineered: YES
    Other Details: TRP OPERON SEQUENCE FROM ESCHERICHIA COLI
    Synthetic: YES
 
Molecule 3 - 5'- D(*TP*GP*TP*AP*CP*CP*AP*GP*TP*AP*CP*AP*CP*GP*AP*GP*TP*AP*CP *A)-3'
    Chains: F
    Engineered: YES
    Other Details: TRP OPERON SEQUENCE FROM ESCHERICHIA COLI
    Synthetic: YES

 Structural Features

(-) Chains, Units

  
NMR Structure (15x): 

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

NMR Structure (1, 2)
No.NameCountTypeFull Name
1TRP2Mod. Amino AcidTRYPTOPHAN

(-) Sites  (2, 2)

NMR Structure (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREARG A:54 , ILE A:57 , THR A:81 , ARG A:84 , GLY A:85 , MET B:42 , LEU B:43 , THR B:44 , PRO B:45 , GLU B:47 , DA E:12 , DC E:13BINDING SITE FOR RESIDUE TRP B 109
2AC2SOFTWARELEU A:43 , THR A:44 , PRO A:45 , ILE B:57 , THR B:81 , ARG B:84 , GLY B:85 , LYS B:90 , DA F:12 , DC F:13BINDING SITE FOR RESIDUE TRP B 201

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1CO0)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1CO0)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1CO0)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1CO0)

(-) Exons   (0, 0)

(no "Exon" information available for 1CO0)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:105
 aligned with TRPR_ECOLI | P0A881 from UniProtKB/Swiss-Prot  Length:108

    Alignment length:105
                                    13        23        33        43        53        63        73        83        93       103     
           TRPR_ECOLI     4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD 108
               SCOP domains d1co0a_ A: Trp repressor, TrpR                                                                            SCOP domains
               CATH domains 1co0A00 A:4-108 Trp Operon Repressor; Chain A                                                             CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .............hhhhhhhhhhhhhh.....hhhhhh....hhhhhhhhhhhhhhhhhh.......hhhhh...hhhhhhhhhhhhh....hhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------- Transcript
                 1co0 A   4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD 108
                                    13        23        33        43        53        63        73        83        93       103     


Chain B from PDB  Type:PROTEIN  Length:107
 aligned with TRPR_ECOLI | P0A881 from UniProtKB/Swiss-Prot  Length:108

    Alignment length:107
                                                                                                                                  108  
                                    13        23        33        43        53        63        73        83        93       103    |  
           TRPR_ECOLI     4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSD--   -
               SCOP domains d1co0b_ B: Trp repressor, TrpR                                                                              SCOP domains
               CATH domains 1co0B00 B:4-108 Trp Operon Repressor; Chain A                                                            -- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ................hhhhhhhhhhh.................hhhhh..hhhhhhh.................hhhhhhhhhhhhh..hhhhhhhhh........ Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------- Transcript
                 1co0 B   4 QSPYSAAMAEQRHQEWLRFVDLLKNAYQNDLHLPLLNLMLTPDEREALGTRVRIVEELLRGEMSQRELKNELGAGIATITRGSNSLKAAPVELRQWLEEVLLKSDWW 201
                                    13        23        33        43        53        63        73        83        93       103    |||
                                                                                                                                  108||
                                                                                                                                   109|
                                                                                                                                    201


Chain E from PDB  Type:DNA  Length:20
                                                    
                 1co0 E   1 TGTACTCGTGTACTGGTACA  20
                                    10        20


Chain F from PDB  Type:DNA  Length:20
                                                    
                 1co0 F   1 TGTACCAGTACACGAGTACA  20
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

NMR Structure
(-)
Class: All alpha proteins (14657)

(-) CATH Domains  (1, 2)

NMR Structure
(-)
Class: Mainly Alpha (13335)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1CO0)

(-) Gene Ontology  (8, 8)

NMR Structure(hide GO term definitions)
Chain A,B   (TRPR_ECOLI | P0A881)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005622    intracellular    The living contents of a cell; the matter contained within (but not including) the plasma membrane, usually taken to exclude large vacuoles and masses of secretory or ingested material. In eukaryotes it includes the nucleus and cytoplasm.

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    TRP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1co0)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ NMR Structure - model 1 PNG format | NMR Structure - model 1, sites PNG format | NMR Structure - all models PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1co0
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TRPR_ECOLI | P0A881
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  TRPR_ECOLI | P0A881
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TRPR_ECOLI | P0A881: 1jhg 1mi7 1rcs 1tro 1trr 1wrp 1wrs 1wrt 1zt9 2oz9 3ssw 3ssx 3wrp

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1CO0)