Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)

(-) Description

Title :  RECOGNITION BY MAX OF ITS COGNATE DNA THROUGH A DIMERIC B/HLH/Z DOMAIN
 
Authors :  A. R. Ferre-D'Amare, G. C. Prendergast, E. B. Ziff, S. K. Burley
Date :  06 Sep 96  (Deposition) - 17 Sep 97  (Release) - 03 Apr 13  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.90
Chains :  Asym. Unit :  A,B
Biol. Unit 1:  A,B  (2x)
Keywords :  Protein-Dna Complex, Double Helix, Transcription-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  A. R. Ferre-D'Amare, G. C. Prendergast, E. B. Ziff, S. K. Burley
Recognition By Max Of Its Cognate Dna Through A Dimeric B/Hlh/Z Domain.
Nature V. 363 38 1993
PubMed-ID: 8479534  |  Reference-DOI: 10.1038/363038A0

(-) Compounds

Molecule 1 - DNA (5'- D(*GP*TP*GP*TP*AP*GP*GP*TP*CP*AP*CP*GP*TP*GP*AP*CP*C P*TP*AP*CP*AP*C)- 3')
    ChainsB
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism CommonHOUSE MOUSE
    Organism ScientificMUS MUSCULUS
    Organism Taxid10090
 
Molecule 2 - PROTEIN (TRANSCRIPTION FACTOR MAX (TF MAX))
    ChainsA
    EngineeredYES
    FragmentDNA BINDING DOMAIN

 Structural Features

(-) Chains, Units

  12
Asymmetric Unit AB
Biological Unit 1 (2x)AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1AN2)

(-) Sites  (0, 0)

(no "Site" information available for 1AN2)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1AN2)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1AN2)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1AN2)

(-) PROSITE Motifs  (1, 1)

Asymmetric Unit (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1BHLHPS50888 Myc-type, basic helix-loop-helix (bHLH) domain profile.MAX_HUMAN23-74  1A:23-74
Biological Unit 1 (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1BHLHPS50888 Myc-type, basic helix-loop-helix (bHLH) domain profile.MAX_HUMAN23-74  2A:23-74

(-) Exons   (3, 3)

Asymmetric Unit (3, 3)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1dENST000003586641dENSE00001956202chr14:65569188-65569022167MAX_HUMAN1-12120--
1.3bENST000003586643bENSE00001013639chr14:65568290-6556826427MAX_HUMAN13-2190--
1.4ENST000003586644ENSE00000941006chr14:65560533-65560426108MAX_HUMAN22-57361A:22-5736
1.6aENST000003586646aENSE00001364326chr14:65544754-65544631124MAX_HUMAN58-99421A:58-9942
1.6fENST000003586646fENSE00001884996chr14:65543381-655422621120MAX_HUMAN99-160621A:99-1079

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:86
 aligned with MAX_HUMAN | P61244 from UniProtKB/Swiss-Prot  Length:160

    Alignment length:86
                                    31        41        51        61        71        81        91       101      
            MAX_HUMAN    22 ADKRAHHNALERKRRDHIKDSFHSLRDSVPSLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALEKARS 107
               SCOP domains d1an2a_ A: Max protein                                                                 SCOP domains
               CATH domains 1an2A00 A:22-107 MYOD Basic-Helix-Loop-Helix Domain, subunit B                         CATH domains
               Pfam domains -------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -BHLH  PDB: A:23-74 UniProt: 23-74                   --------------------------------- PROSITE
           Transcript 1 (1) Exon 1.4  PDB: A:22-57              Exon 1.6a  PDB: A:58-99 UniProt: 58-99    -------- Transcript 1 (1)
           Transcript 1 (2) -----------------------------------------------------------------------------Exon 1.6f Transcript 1 (2)
                 1an2 A  22 ADKRAHHNALERKRRDHIKDSFHSLRDSVPSLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALEKARS 107
                                    31        41        51        61        71        81        91       101      

Chain B from PDB  Type:DNA  Length:22
                                                      
                 1an2 B   1 GTGTAGGTCACGTGACCTACAC  22
                                    10        20  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 1)

Asymmetric Unit

(-) CATH Domains  (1, 1)

Asymmetric Unit

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1AN2)

(-) Gene Ontology  (32, 32)

Asymmetric Unit(hide GO term definitions)
Chain A   (MAX_HUMAN | P61244)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0032403    protein complex binding    Interacting selectively and non-covalently with any protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046983    protein dimerization activity    The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits.
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0042803    protein homodimerization activity    Interacting selectively and non-covalently with an identical protein to form a homodimer.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003713    transcription coactivator activity    Interacting selectively and non-covalently with a activating transcription factor and also with the basal transcription machinery in order to increase the frequency, rate or extent of transcription. Cofactors generally do not bind the template nucleic acid, but rather mediate protein-protein interactions between activating transcription factors and the basal transcription machinery.
    GO:0003712    transcription cofactor activity    Interacting selectively and non-covalently with a regulatory transcription factor and also with the basal transcription machinery in order to modulate transcription. Cofactors generally do not bind the template nucleic acid, but rather mediate protein-protein interactions between regulatory transcription factors and the basal transcription machinery.
    GO:0000983    transcription factor activity, RNA polymerase II core promoter sequence-specific    Interacting selectively and non-covalently with a specific DNA sequence in an RNA polymerase II (Pol II) core promoter, the region composed of the transcription start site and binding sites for transcription factors of the Pol II basal transcription machinery, in order to modulate transcription by Pol II. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0071375    cellular response to peptide hormone stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a peptide hormone stimulus. A peptide hormone is any of a class of peptides that are secreted into the blood stream and have endocrine functions in living animals.
    GO:0009267    cellular response to starvation    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment.
    GO:0010629    negative regulation of gene expression    Any process that decreases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
    GO:0051402    neuron apoptotic process    Any apoptotic process in a neuron, the basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.
    GO:0006461    protein complex assembly    The aggregation, arrangement and bonding together of a set of components to form a protein complex.
    GO:0006357    regulation of transcription from RNA polymerase II promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0048678    response to axon injury    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an axon injury stimulus.
    GO:0032868    response to insulin    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an insulin stimulus. Insulin is a polypeptide hormone produced by the islets of Langerhans of the pancreas in mammals, and by the homologous organs of other organisms.
    GO:0010243    response to organonitrogen compound    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an organonitrogen stimulus. An organonitrogen compound is formally a compound containing at least one carbon-nitrogen bond.
    GO:0060041    retina development in camera-type eye    The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0071339    MLL1 complex    A protein complex that can methylate lysine-4 of histone H3. MLL1/MLL is the catalytic methyltransferase subunit, and the complex also contains the core components ASH2L, HCFC1/HCF1 WDR5 and RBBP5.
    GO:0016605    PML body    A class of nuclear body; they react against SP100 auto-antibodies (PML, promyelocytic leukemia); cells typically contain 10-30 PML bodies per nucleus; alterations in the localization of PML bodies occurs after viral infection.
    GO:0042995    cell projection    A prolongation or process extending from a cell, e.g. a flagellum or axon.
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0030425    dendrite    A neuron projection that has a short, tapering, often branched, morphology, receives and integrates signals from other neurons or from sensory stimuli, and conducts a nerve impulse towards the axon or the cell body. In most neurons, the impulse is conveyed from dendrites to axon via the cell body, but in some types of unipolar neuron, the impulse does not travel via the cell body.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1an2)
 
  Sites
(no "Sites" information available for 1an2)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1an2)
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1an2
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  MAX_HUMAN | P61244
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  0064
    Age Related InformationGenAge
  0208
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  MAX_HUMAN | P61244
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        MAX_HUMAN | P612441hlo 1nkp 1nlw 1r05 5eyo

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1AN2)