Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE BACTERIAL RIBOSOMAL DECODING SITE IN COMPLEX WITH SYNTHETIC AMINOGLYCOSIDE WITH F-HABA GROUP
 
Authors :  J. P. Maianti, H. Kanazawa, P. Dozzo, L. A. Feeney, E. S. Armstrong, J. Ko S. Hanessian
Date :  27 Feb 14  (Deposition) - 05 Nov 14  (Release) - 05 Nov 14  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.30
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Ribosomal Rna, Aminoglycoside, Rna-Antibiotic Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  J. P. Maianti, H. Kanazawa, P. Dozzo, R. D. Matias, L. A. Feeney, E. S. Armstrong, D. J. Hildebrandt, T. R. Kane, M. J. Gliedt, A. A. Goldblum, M. S. Linsell, J. B. Aggen, J. Kondo, S. Hanessian
Toxicity Modulation, Resistance Enzyme Evasion, And A-Site X-Ray Structure Of Broad-Spectrum Antibacterial Neomycin Analogs
Acs Chem. Biol. V. 9 2067 2014
PubMed-ID: 25019242  |  Reference-DOI: 10.1021/CB5003416

(-) Compounds

Molecule 1 - RNA (5'- R(*UP*UP*GP*CP*GP*UP*CP*AP*CP*GP*CP*CP*GP*GP*CP*GP*AP*AP*GP*UP*CP*GP* C)-3')
    Chains: A, B
    Engineered: YES
    Synthetic: YES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit : AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 3)

Asymmetric/Biological Unit (2, 3)
No.NameCountTypeFull Name
1K1Ligand/IonPOTASSIUM ION
2SJP2Ligand/Ion(2R,3R)-4-AMINO-N-[(1R,2S,3R,4R,5S)-5-AMINO-4-[(2,6-DIAMINO-2,3,4,6-TETRADEOXY-ALPHA-D-ERYTHRO-HEXOPYRANOSYL)OXY]-3-{[3-O-(2,6-DIAMINO-2,3,4,6-TETRADEOXY-BETA-L-THREO-HEXOPYRANOSYL)-BETA-D-RIBOFURANOSYL]OXY}-2-HYDROXYCYCLOHEXYL]-3-FLUORO-2-HYDROXYBUTANAMIDE

(-) Sites  (3, 3)

Asymmetric Unit (3, 3)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREC A:15 , G A:16 , A A:18 , G A:19 , U A:20 , C A:21 , G A:22 , C A:23 , HOH A:207 , HOH A:215 , C B:27 , G B:28 , C B:30 , A B:31 , HOH B:203 , HOH B:227BINDING SITE FOR RESIDUE SJP A 101
2AC2SOFTWAREG A:3 , C A:4 , G A:5 , C A:7 , A A:8 , HOH A:202 , HOH A:206 , HOH A:223 , C B:38 , G B:39 , A B:41 , G B:42 , U B:43 , C B:44 , G B:45 , C B:46 , HOH B:204 , HOH B:206 , HOH B:209BINDING SITE FOR RESIDUE SJP B 101
3AC3SOFTWAREG B:37BINDING SITE FOR RESIDUE K B 102

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3WRU)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 3WRU)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3WRU)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 3WRU)

(-) Exons   (0, 0)

(no "Exon" information available for 3WRU)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:21
                                                    
                  3wru A  3 GCGUCACGCCGGCGAAGUCGC 23
                                    12        22 


Chain B from PDB  Type:RNA  Length:21
                                                    
                  3wru B 26 GCGUCACGCCGGCGAAGUCGC 46
                                    35        45
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 3WRU)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 3WRU)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3WRU)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 3WRU)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    SJP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 3wru)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3wru
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 3WRU)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 3WRU)