Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE ACIDAMINOCOCCUS SP. BV3L6 CPF1 RR VARIANT IN COMPLEX WITH CRRNA AND TARGET DNA (TCCA PAM)
 
Authors :  H. Nishimasu, T. Yamano, R. Ishitani, O. Nureki
Date :  19 Apr 17  (Deposition) - 14 Jun 17  (Release) - 14 Jun 17  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.00
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Nuclease, Hydrolase-Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  H. Nishimasu, T. Yamano, L. Gao, F. Zhang, R. Ishitani, O. Nureki
Structural Basis For The Altered Pam Recognition By Engineered Crispr-Cpf1
Mol. Cell V. 67 2017
PubMed: search  |  Reference-DOI: 10.1016/J.MOLCEL.2017.04.019

(-) Compounds

Molecule 1 - CRISPR-ASSOCIATED ENDONUCLEASE CPF1
    Chains: A
    EC Number: 3.1.-.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Gene: CPF1, HMPREF1246_0236
    Mutation: YES
    Organism Scientific: ACIDAMINOCOCCUS SP. (STRAIN BV3L6)
    Organism Taxid: 1111120
    Strain: BV3L6
    Synonym: ASCPF1
 
Molecule 2 - CRRNA
    Chains: B
    Engineered: YES
    Organism Scientific: ACIDAMINOCOCCUS SP. BV3L6
    Organism Taxid: 1111120
    Other Details: RNA (40-MER)
    Synthetic: YES
 
Molecule 3 - TARGET DNA STRAND
    Chains: C
    Engineered: YES
    Organism Scientific: ACIDAMINOCOCCUS SP. BV3L6
    Organism Taxid: 1111120
    Other Details: DNA (30-MER)
    Synthetic: YES
 
Molecule 4 - NON-TARGET DNA STRAND
    Chains: D
    Engineered: YES
    Organism Scientific: ACIDAMINOCOCCUS SP. BV3L6
    Organism Taxid: 1111120
    Other Details: DNA (5'-D(*CP*AP*GP*TP*CP*CP*TP*CP*CP*A)-3')
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 22)

Asymmetric/Biological Unit (3, 22)
No.NameCountTypeFull Name
1CL1Ligand/IonCHLORIDE ION
2EDO16Ligand/Ion1,2-ETHANEDIOL
3NA5Ligand/IonSODIUM ION

(-) Sites  (22, 22)

Asymmetric Unit (22, 22)
No.NameEvidenceResiduesDescription
01AC1SOFTWARELYS A:757 , HOH A:1575 , HOH A:1752 , A B:-4 , HOH B:263 , HOH B:265binding site for residue NA A 1401
02AC2SOFTWARETYR A:1069 , THR A:1070 , SER A:1071 , LYS A:1072binding site for residue CL A 1402
03AC3SOFTWAREHIS A:977 , VAL A:980 , ASP A:981 , LEU A:1028 , HOH A:1595 , G B:-3 , A B:-2binding site for residue EDO A 1403
04AC4SOFTWAREVAL A:13 , SER A:14 , LYS A:15 , ASP A:1021 , HOH B:252binding site for residue EDO A 1404
05AC5SOFTWARETHR A:2 , GLN A:3 , GLY A:6 , PHE A:7 , ARG A:891 , HOH A:1644binding site for residue EDO A 1405
06AC6SOFTWAREPHE A:1079 , VAL A:1080 , MET A:1119 , LEU A:1129 , GLY A:1131 , GLN A:1303binding site for residue EDO A 1406
07AC7SOFTWARELYS A:559 , ASN A:560 , GLY A:561 , ASP A:591binding site for residue EDO A 1407
08AC8SOFTWARELEU A:95 , ILE A:96 , GLN A:99 , HOH A:1891binding site for residue EDO A 1408
09AC9SOFTWAREASP A:591 , PHE A:769 , HOH A:1506binding site for residue EDO A 1409
10AD1SOFTWARELYS A:530 , ARG A:790 , PHE A:870 , HIS A:872 , HOH A:1682 , U B:-15 , U B:-16binding site for residue EDO A 1410
11AD2SOFTWAREGLY A:171 , GLU A:174 , ASN A:175 , HOH A:1822 , A B:3 , DC C:-1 , DT C:-2binding site for residue EDO A 1411
12AD3SOFTWAREPRO A:23 , ASP A:867 , PHE A:869 , HOH A:1708 , HOH A:1817binding site for residue EDO A 1412
13AD4SOFTWARETYR A:687 , LYS A:689 , DG C:3binding site for residue EDO A 1413
14AD5SOFTWAREGLU A:581 , VAL A:1247 , PHE A:1249 , ASN A:1255 , TRP A:1258 , HOH A:1781 , HOH A:1889binding site for residue EDO A 1414
15AD6SOFTWAREGLN A:24binding site for residue EDO A 1415
16AD7SOFTWAREU B:10 , G B:11 , HOH B:251 , HOH B:294 , HOH B:309 , HOH C:214binding site for residue NA B 101
17AD8SOFTWAREA B:2 , HOH B:202 , HOH B:212 , HOH B:293 , HOH B:303binding site for residue NA B 102
18AD9SOFTWAREU B:16 , G B:17 , HOH B:215 , HOH B:260 , HOH B:297 , HOH B:308binding site for residue NA B 103
19AE1SOFTWAREHIS A:755 , C B:-9 , U B:-8 , U B:-5binding site for residue EDO B 104
20AE2SOFTWARETHR A:16 , GLN A:784 , GLU A:786 , G B:0 , G B:1 , A B:2 , HOH B:231binding site for residue EDO B 105
21AE3SOFTWARETYR A:823 , U B:-10 , A B:-19binding site for residue EDO B 106
22AE4SOFTWAREHOH B:264 , HOH B:307 , DG C:-14 , HOH C:242 , HOH C:247 , HOH C:261binding site for residue NA C 101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5XH7)

(-) Cis Peptide Bonds  (1, 1)

Asymmetric/Biological Unit
No.Residues
1Glu A:651 -Pro A:652

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5XH7)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5XH7)

(-) Exons   (0, 0)

(no "Exon" information available for 5XH7)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:1283
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhh.....eeeeeeeeeee..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhh..hhhhhhhhhhhhhh....hhhhhhhhhh...hhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhh...hhhhhhhhhhhhhh...........hhhhhhhhhhhh.hhhhhhhhhh..........................hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...hhhh.ee...hhhhhhhhhh...hhhhhhhhhhhhh......hhhhhhhhhhhhhhh.eehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh........eee...........hhhhhhhhheeeeee..eeeeee..............ee.....eeeeeeeee..hhhhhhhhh...hhhhhhhhhhh...eee.......eeehhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh............hhhhh.hhhhhhhhhh...eeeeeeeeehhhhhhhhhh...eeeeeehhhhh.......hhhhhhhhhhhhhhhhhh..eee....eeeee......ee....eee...........hhhhhhhhhhhhh.......hhhhhhhhhhh.eee....ee.hhhhh..eeeeeeeeee.........hhhhhhhhhhhhh....eeeee.......eeeee.....eeeeee..ee..eehhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhh.eeeee.....hhhhhhhhhhhhhhh................................ee..eeee..................hhhhh.hhhhhhhhhhh..eeee......eeeeee...hhhhh........eeeeee....eee.....eee...eee..eeehhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhhhhhhhhh.eee......eeeeeeee.....eee.hhh......hhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                5xh7 A    1 MTQFEGFTNLYQVSKTLRFELIPQGKTLKHIQEQGFIEEDKARNDHYKELKPIIDRIYKTYADQCLQLVQLDWENLSAAIDSYRKEKTEETRNALIEEQATYRNAIHDYFIGRTDNLTDAINKRHAEIYKGLFKAELFNGKVLKQLGTVTTTEHENALLRSFDKFTTYFSGFYENRKNVFSAEDISTAIPHRIVQDNFPKFKENCHIFTRLITAVPSLREHFENVKKAIGIFVSTSIEEVFSFPFYNQLLTQTQIDLYNQLLGGISREAGTEKIKGLNEVLNLAIQKNDETAHIIASLPHRFIPLFKQILSDRNTLSFILEEFKSDEEVIQSFCKYKTLLRNENVLETAEALFNELNSIDLTHIFISHKKLETISSALCDHWDTLRNALYERRISELTGKITKSAKEKVQRSLKHEDINLQEIISAAGKELSEAFKQKTSEILSHAHAALDQPLPTTLKKQEEKEILKSQLDSLLGLYHLLDWFAVDESNEVDPEFSARLTGIKLEMEPSLSFYNKARNYATKKPYSVEKFKLNFQMPTLARGWDVNKEKNNGAILFVKNGLYYLGIMPKQKGRYKALSFEPTEKTSEGFDKMYYDYFPDAAKMIPRCSTQLKAVTAHFQTHTTPILLSNNFIEPLEITKEIYDLNNPEKEPKKFQTAYAKKTGDQKGYREALCKWIDFTRDFLSKYTKTTSIDLSSLRPSSQYKDLGEYYAELNPLLYHISFQRIAEKEIMDAVETGKLYLFQIYNKDFAKGHHGKPNLHTLYWTGLFSPENLAKTSIKLNGQAELFYRPKSRMMAHRLGEKMLNKKLKDQKTPIPDTLYQELYDYVNHRLSHDLSDEARALLPNVITKEVSHEIIKDRRFTSDKFFFHVPITLNYQAANSPSKFNQRVNAYLKEHPETPIIGIDRGERNLIYITVIDSTGKILEQRSLNTIQQFDYQKKLDNREKERVAARQAWSVVGTIKDLKQGYLSQVIHEIVDLMIHYQAVVVLENLNFAVYQQFEKMLIDKLNCLVLKDYPAEKVGGVLNPYQLTDQFTSFAKMGTQSGFLFYVPAPYTSKIDPLTGFVDPFVWKTIKNHESRKHFLEGFDFLHYDVKTGDFILHFKMNRNLSFQRGLPGFMPAWDIVFEKNETQFDAKGTPFIAGKRIVPYRDLYPANELIALLEEKGIVFRDGSNILPKLLENDDSHAIDTMVALIRSVLQMRNSNAATGEDYINSPVRDLNGVCFDSRFQNPEWPMDADANGAYHIALKGQLLLNHLKESKDLKLQNGISNQDWLAYIQELRN 1307
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790    || 802       812       822       832       842       852       862       872       882       892       902       912       922       932       942       952       962       972       982       992    ||1014      1024      1034      1044      1054      1064      1074      1084      1094      1104      1114      1124      1134      1144      1154      1174      1184      1194      1204      1214      1224      1234      1244      1254      1264      1274      1284      1294      1304   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    795|                                                                                                                                                                                                    997|                                                                                                                                                    1162|                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     798                                                                                                                                                                                                    1010                                                                                                                                                     1173                                                                                                                                      


Chain B from PDB  Type:DNA/RNA  Length:40
                                                                         
                5xh7 B  -19 AAUUUCUACUCUUGUAGAUGGAAAUUAGGUGCGCUUGGCA   20
                                   -10         0        10        20


Chain C from PDB  Type:DNA  Length:30
                                                               
                5xh7 C  -19 GCCAAGCGCACCTAATTTCCTGGAGGACTG   10
                                   -10         0        10


Chain D from PDB  Type:DNA  Length:10
                                           
                5xh7 D  -10 CAGTCCTCCA   -1
                                    -1
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5XH7)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5XH7)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5XH7)

(-) Gene Ontology  (5, 5)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    NA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
    AE1  [ RasMol ]  +environment [ RasMol ]
    AE2  [ RasMol ]  +environment [ RasMol ]
    AE3  [ RasMol ]  +environment [ RasMol ]
    AE4  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Glu A:651 - Pro A:652   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5xh7
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CPF1_ACISB | U2UMQ6
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  CPF1_ACISB | U2UMQ6
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        CPF1_ACISB | U2UMQ6: 5b43 5kk5 5xh6

(-) Related Entries Specified in the PDB File

5xh6