Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  ENGINEERED VARIANT OF I-ONUI MEGANUCLEASE TARGETING THE HIV CCR5 GENE; HARBORS 43 POINT MUTATIONS RELATIVE TO WILD-TYPE I-ONUI
 
Authors :  J. P. Hallinan, B. L. Stoddard
Date :  29 Sep 16  (Deposition) - 03 May 17  (Release) - 03 May 17  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.11
Chains :  Asym. Unit :  A,B,C,D,E,F
Biol. Unit 1:  A,B,C  (1x)
Biol. Unit 2:  D,E,F  (1x)
Keywords :  Meganuclease, Engineered Protein, Dna Complex, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  R. Werther, J. P. Hallinan, A. Lambert, K. Haven, J. Jarjor, B. L. Stoddard
The Structural Basis Of Altered Gene Specificity Resulting From Meganuclease And Megatal Engineering
To Be Published
PubMed: search

(-) Compounds

Molecule 1 - I-ONUI_E-HCCR5
    Chains: A, D
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
 
Molecule 2 - DNA (29-MER)
    Chains: B, E
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES
 
Molecule 3 - DNA (29-MER)
    Chains: C, F
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123456
Asymmetric Unit : ABCDEF
Biological Unit 1 (1x): ABC   
Biological Unit 2 (1x):    DEF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 6)

Asymmetric Unit (2, 6)
No.NameCountTypeFull Name
1CA4Ligand/IonCALCIUM ION
2GOL2Ligand/IonGLYCEROL
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
2GOL1Ligand/IonGLYCEROL
Biological Unit 2 (1, 1)
No.NameCountTypeFull Name
1CA-1Ligand/IonCALCIUM ION
2GOL1Ligand/IonGLYCEROL

(-) Sites  (6, 6)

Asymmetric Unit (6, 6)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLU A:22 , GLY A:177 , DT B:18 , DT C:17 , HOH C:101binding site for residue CA A 401
2AC2SOFTWAREALA A:21 , GLU A:22 , GLU A:178 , HOH A:501 , DC B:17 , DT C:17 , DT C:18binding site for residue CA A 402
3AC3SOFTWAREDG B:11 , DG B:12 , DA B:13binding site for residue GOL B 101
4AC4SOFTWAREGLU D:22 , GLY D:177 , DT E:18 , DT F:17binding site for residue CA D 401
5AC5SOFTWAREALA D:21 , GLU D:22 , GLU D:178 , DC E:17 , DT F:17 , DT F:18binding site for residue CA D 402
6AC6SOFTWAREDG E:11 , DG E:12 , DA E:13binding site for residue GOL E 101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5THG)

(-) Cis Peptide Bonds  (1, 1)

Asymmetric Unit
No.Residues
1Gly A:232 -Ser A:233

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5THG)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5THG)

(-) Exons   (0, 0)

(no "Exon" information available for 5THG)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:294
                                                                                                                                                                                                                                                                                                                                      
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ....hhhhhhhhhhhh.eeeeeeee.......eeeeeeeeeeee..hhhhhhhhhhhhh..eeee....eeeeee.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhh......hhhhhhhh..............hhhhhhhhhhhheeeeeeee.......eeeeeeeeeehhhhhhhhhhhhhhhh..eeee........eeeee.hhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 5thg A   7 RESINPWILTGFTDAEGSFMLRIRNTNNRSVGYYTSLVFEITLHNKDKSILENIQSTWKVGTINNRGDGTARLSVTRFEDLKVIIDHFEKYPLITQKLGDYKLFKQAFSVMENKEHLKENGIKELVRIKAKMNWGLNDELKKAFPENIERPLINKNIPNLKWLAGFTSGEGTFYVHLAKEASGKVYVRLRFIIGQHIRDKNLMNSLITYLGCGTIQEKNRSKGSMLHFIVTKFSDINDKIIPVFQENTLIGVKLEDFEDWCKVAKLIEEKKHLTESGLDEIKKIKLNMNKGRVF 303
                                    16        26        36        46        56        66        76        86        96       106       116       126       136       146       158       168       178       189       199       209       219       229       239       249       259       269       279       289       299    
                                                                                                                                                                             154|                           187|                                                                                                                  
                                                                                                                                                                              157                            189                                                                                                                  


Chain B from PDB  Type:DNA  Length:28
                                                            
                 5thg B   2 CACCTTCCAGGAATTCTTTGGCCTGCAC  29
                                    11        21        


Chain C from PDB  Type:DNA  Length:28
                                                            
                 5thg C   1 GGTGCAGGCCAAAGAATTCCTGGAAGGT  28
                                    10        20        


Chain D from PDB  Type:PROTEIN  Length:291
                                                                                                                                                                                                                                                                                                                                   
               SCOP domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhh.eeeeeeee.....eeeeeeeeeeee..hhhhhhhhhhhhh..eeee....eeeeee.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhh......hhhhhhhh..............hhhhhhhhhhhheeeeee.........eeeeeeeee..hhhhhhhhhhhhh..eeee.......eeeeee.hhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhh....... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5thg D   6 RRESINPWILTGFTDAEGSFMLRIRNTRSVGYYTSLVFEITLHNKDKSILENIQSTWKVGTINNRGDGTARLSVTRFEDLKVIIDHFEKYPLITQKLGDYKLFKQAFSVMENKEHLKENGIKELVRIKAKMNWGLNDELKKAFPENIERPLINKNIPNLKWLAGFTSGEGTFYVHLEASGKVYVRLRFIIGQHIRDKNLMNSLITYLGCGTIQEKNRSKGSMLHFIVTKFSDINDKIIPVFQENTLIGVKLEDFEDWCKVAKLIEEKKHLTESGLDEIKKIKLNMNKGRVF 303
                                    15        25      ||37        47        57        67        77        87        97       107       117       127       137       147      |159       169       179     ||192       202       212       222       232       242       252       262       272       282       292       302 
                                                     32|                                                                                                                    154|                         185|                                                                                                                  
                                                      35                                                                                                                     157                          189                                                                                                                  


Chain E from PDB  Type:DNA  Length:28
                                                            
                 5thg E   2 CACCTTCCAGGAATTCTTTGGCCTGCAC  29
                                    11        21        


Chain F from PDB  Type:DNA  Length:29
                                                             
                 5thg F   1 GGTGCAGGCCAAAGAATTCCTGGAAGGTG  29
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5THG)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5THG)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5THG)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5THG)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    GOL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Gly A:232 - Ser A:233   [ RasMol ]  
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5thg
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5THG)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5THG)