Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - model 1
(-)NMR Structure - model 1, sites
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - model 1, sites
NMR Structure - model 1, sites  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  SOLUTION STRUCTURE OF A HUMAN G-QUADRUPLEX HYBRID-2 FORM IN COMPLEX WITH A GOLD-LIGAND
 
Authors :  J. Wirmer-Bartoschek, H. R. A. Jonker, L. E. Bendel, T. Gruen, C. Bazzic L. Messori, P. Gratteri, H. Schwalbe
Date :  16 Jan 17  (Deposition) - 31 May 17  (Release) - 14 Jun 17  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A  (10x)
NMR Structure *:  A  (1x)
Keywords :  G-Quadruplex Hybrid, 2 Auoxo6, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  J. Wirmer-Bartoschek, L. E. Bendel, H. R. A. Jonker, J. T. Grun, F. Papi C. Bazzicalupi, L. Messori, P. Gratteri, H. Schwalbe
Solution Nmr Structure Of A Ligand/Hybrid-2-G-Quadruplex Complex Reveals Rearrangements That Affect Ligand Binding.
Angew. Chem. Int. Ed. Engl. V. 56 7102 2017
PubMed-ID: 28524432  |  Reference-DOI: 10.1002/ANIE.201702135

(-) Compounds

Molecule 1 - DNA (26-MER)
    Chains: A
    Engineered: YES
    Organism Scientific: HOMO SAPIENS
    Organism Taxid: 9606
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1
NMR Structure (10x): A
NMR Structure * (1x): A

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 3)

NMR Structure (2, 3)
No.NameCountTypeFull Name
1AUZ1Ligand/IonBIS(M2-OXO)-BIS(2-METHYL-2,2'-BIPYRIDINE)-DI-GOLD(III)
2K2Ligand/IonPOTASSIUM ION
NMR Structure * (1, 1)
No.NameCountTypeFull Name
1AUZ1Ligand/IonBIS(M2-OXO)-BIS(2-METHYL-2,2'-BIPYRIDINE)-DI-GOLD(III)
2K-1Ligand/IonPOTASSIUM ION

(-) Sites  (3, 3)

NMR Structure (3, 3)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREDG A:4 , DG A:5 , DG A:11 , DG A:12 , DG A:16 , DG A:17 , DG A:22 , DG A:23binding site for residue K A 101
2AC2SOFTWAREDG A:5 , DG A:6 , DG A:10 , DG A:11 , DG A:17 , DG A:18 , DG A:23 , DG A:24binding site for residue K A 102
3AC3SOFTWAREDA A:3 , DG A:4 , DG A:12 , DT A:14 , DA A:15 , DG A:16binding site for residue AUZ A 103

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5MVB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5MVB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5MVB)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5MVB)

(-) Exons   (0, 0)

(no "Exon" information available for 5MVB)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:DNA  Length:26
                                                         
                  5mvb A  1 TTAGGGTTAGGGTTAGGGTTAGGGTT 26
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5MVB)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5MVB)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5MVB)

(-) Gene Ontology  (0, 0)

NMR Structure(hide GO term definitions)
    (no "Gene Ontology" information available for 5MVB)

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    AUZ  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5mvb)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ NMR Structure - model 1 PNG format | NMR Structure - model 1, sites PNG format | NMR Structure - all models PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5mvb
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5MVB)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5MVB)