Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF R.PABI-NONSPECIFIC DNA COMPLEX
 
Authors :  D. Wang, K. Miyazono, M. Tanokura
Date :  26 Feb 16  (Deposition) - 23 Nov 16  (Release) - 23 Nov 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.90
Chains :  Asym. Unit :  A,B,C
Biol. Unit 1:  A,B,C  (2x)
Keywords :  Restriction Enzyme, Dna Glycosylase, Hydrolase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  D. Wang, K. I. Miyazono, M. Tanokura
Tetrameric Structure Of The Restriction Dna Glycosylase R. Pabi In Complex With Nonspecific Double-Stranded Dna.
Sci Rep V. 6 35197 2016
PubMed-ID: 27731370  |  Reference-DOI: 10.1038/SREP35197

(-) Compounds

Molecule 1 - UNCHARACTERIZED PROTEIN
    Chains: A, B
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Fragment: UNP RESIDUES 8-226
    Gene: PAB0105
    Mutation: YES
    Organism Scientific: PYROCOCCUS ABYSSI
    Organism Taxid: 272844
    Strain: GE5 / ORSAY
    Synonym: R.PABI
 
Molecule 2 - DNA (5'- D(*GP*CP*AP*CP*TP*AP*GP*TP*TP*CP*GP*AP*AP*CP*TP*AP*GP*TP*GP*C)-3')
    Chains: C
    Engineered: YES
    Organism Scientific: SYNTHETIC CONSTRUCT
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  123
Asymmetric Unit : ABC
Biological Unit 1 (2x): ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 5IFF)

(-) Sites  (0, 0)

(no "Site" information available for 5IFF)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5IFF)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric Unit
No.Residues
1Glu A:174 -Pro A:175
2Glu B:174 -Pro B:175

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5IFF)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5IFF)

(-) Exons   (0, 0)

(no "Exon" information available for 5IFF)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:216
                                                                                                                                                                                                                                                        
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..eeeee..eeeeeee.......eeeee.hhhh...ee........hhhhh.eeeeee...........hhhhhhhhhhhh...hhhhhhhhhhhhhhh..hhhhhh.eeeeeeeee..eeeeeeeeeeeeee.....eeeeeeee......eeeeeeeeee.hhh.............eeeeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 5iff A   8 EASVSFENGKIVVRLPITRPTSKIAVKKIENGVGIPVSTRKKSFPSDENLRDYYIAWQISYARDGKYDYELSRMVRLAHEHGILTYNDIYELLKFADDVKSYLEDKGIRRESTNEELYGFNIYEDVYPVAKKELPSGEFIGIVLKHKQRAVGYQSMVYVCIPLTNVEPSLAGRVARRNEVVKYEVPVDLMKELLKAFIIASETHKNDIVKFLRSII 223
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217      


Chain B from PDB  Type:PROTEIN  Length:212
                                                                                                                                                                                                                                                    
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..eeeee..eeeeeee.......eeeeeee..eeee............eeeeee...........hhhhhhhhhhhh...hhhhhhhhhhhhhhh..hhhhhh.eeeeeeeee..eeeeeeeeeeeeee.....eeeeeeee......eeeeeeeeee.hhh.............eeeee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5iff B   8 EASVSFENGKIVVRLPITRPTSKIAVKKIENGVGIPVSTRKKSFPLRDYYIAWQISYARDGKYDYELSRMVRLAHEHGILTYNDIYELLKFADDVKSYLEDKGIRRESTNEELYGFNIYEDVYPVAKKELPSGEFIGIVLKHKQRAVGYQSMVYVCIPLTNVEPSLAGRVARRNEVVKYEVPVDLMKELLKAFIIASETHKNDIVKFLRSII 223
                                    17        27        37        47    ||  61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221  
                                                                       52|                                                                                                                                                                      
                                                                        57                                                                                                                                                                      


Chain C from PDB  Type:DNA  Length:20
                                                    
                 5iff C   1 GCACTAGTTCGAACTAGTGC  20
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5IFF)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5IFF)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5IFF)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5IFF)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 5iff)
 
  Sites
(no "Sites" information available for 5iff)
 
  Cis Peptide Bonds
    Glu A:174 - Pro A:175   [ RasMol ]  
    Glu B:174 - Pro B:175   [ RasMol ]  
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Biol. Unit 1 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5iff
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  Q9V2B6_PYRAB | Q9V2B6
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/TrEMBL
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  Q9V2B6_PYRAB | Q9V2B6
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/TrEMBL
        Q9V2B6_PYRAB | Q9V2B6: 2dvy 3waz

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5IFF)