Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE STREPTOCOCCUS PYOGENES CAS9 VQR VARIANT IN COMPLEX WITH SGRNA AND TARGET DNA (TGA PAM)
 
Authors :  S. Hirano, H. Nishimasu, R. Ishitani, O. Nureki
Date :  02 Feb 16  (Deposition) - 23 Mar 16  (Release) - 06 Apr 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.00
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Crispr-Cas9, Genome Engineering, Hydrolase-Rna-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  S. Hirano, H. Nishimasu, R. Ishitani, O. Nureki
Structural Basis For The Altered Pam Specificities Of Engineered Crispr-Cas9
Mol. Cell V. 61 886 2016
PubMed-ID: 26990991  |  Reference-DOI: 10.1016/J.MOLCEL.2016.02.018

(-) Compounds

Molecule 1 - GUIDE RNA
    Chains: A
    Engineered: YES
    Organism Scientific: STREPTOCOCCUS PYOGENES
    Organism Taxid: 1314
    Other Details: IN VITRO TRANSCRIPTION
    Synthetic: YES
 
Molecule 2 - CRISPR-ASSOCIATED ENDONUCLEASE CAS9
    Chains: B
    EC Number: 3.1.-.-
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Taxid: 562
    Gene: CAS9, CSN1, SPY_1046
    Mutation: YES
    Organism Scientific: STREPTOCOCCUS PYOGENES SEROTYPE M1
    Organism Taxid: 301447
    Strain: SEROTYPE M1
    Synonym: SPYCAS9
 
Molecule 3 - TARGET DNA
    Chains: C
    Engineered: YES
    Organism Scientific: STREPTOCOCCUS PYOGENES
    Organism Taxid: 1314
    Other Details: CHEMICAL SYNTHESIS
    Synthetic: YES
 
Molecule 4 - NON-TARGET DNA, DNA (5'-D(*TP*GP*AP*GP*AP*TP*TP*G)-3')
    Chains: D
    Engineered: YES
    Organism Scientific: STREPTOCOCCUS PYOGENES
    Organism Taxid: 1314
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (4, 19)

Asymmetric/Biological Unit (4, 19)
No.NameCountTypeFull Name
1ACT1Ligand/IonACETATE ION
2EDO4Ligand/Ion1,2-ETHANEDIOL
3K11Ligand/IonPOTASSIUM ION
4MG3Ligand/IonMAGNESIUM ION

(-) Sites  (19, 19)

Asymmetric Unit (19, 19)
No.NameEvidenceResiduesDescription
01AC1SOFTWAREA A:65 , U A:66 , HOH A:219 , HOH A:331 , HOH A:364 , THR B:1102 , HOH B:1749binding site for residue K A 101
02AC2SOFTWAREA A:68 , HOH A:311 , GLN B:1350 , HOH B:1803 , HOH B:1871 , HOH B:1981binding site for residue K A 102
03AC3SOFTWAREG A:21 , HOH A:260 , HOH A:291 , HOH A:344 , HOH A:385 , HOH A:397binding site for residue K A 103
04AC4SOFTWAREU A:50 , HOH A:289 , HOH A:305 , HOH A:316 , HOH A:356 , HOH A:371binding site for residue MG A 104
05AC5SOFTWAREG A:21 , U A:22 , HOH A:203 , HOH A:350 , HOH A:369 , HOH A:385 , HOH A:386 , HOH B:1964binding site for residue MG A 105
06AC6SOFTWAREU A:63 , U A:64 , HOH A:205 , HOH A:283 , HOH A:337 , ARG B:461binding site for residue EDO A 106
07AC7SOFTWAREA A:65 , U A:66 , C A:67 , ARG B:1171binding site for residue ACT A 107
08AC8SOFTWAREU A:22 , ASP B:364 , GLY B:365binding site for residue K A 108
09AC9SOFTWARELEU B:623 , THR B:624 , PHE B:626 , TYR B:656 , HOH C:134binding site for residue K B 1401
10AD1SOFTWAREGLU B:584 , ARG B:586 , ASN B:588 , HOH B:1501 , HOH B:1854 , HOH C:146binding site for residue K B 1402
11AD2SOFTWAREGLY B:361 , TYR B:362 , GLY B:365 , GLY B:366 , ALA B:367 , HOH B:1909binding site for residue K B 1403
12AD3SOFTWAREILE B:226 , LEU B:229 , GLU B:232 , HOH B:1934binding site for residue K B 1404
13AD4SOFTWAREGLU B:108 , LYS B:111 , HOH B:1962binding site for residue K B 1405
14AD5SOFTWAREHOH A:219 , HOH A:296 , GLU B:57 , HOH B:1861 , HOH B:1923 , HOH B:1927binding site for residue K B 1406
15AD6SOFTWAREASP B:576 , SER B:577 , ALA B:640 , PHE B:643binding site for residue K B 1407
16AD7SOFTWAREHOH A:215 , HOH A:229 , HOH A:377 , HOH B:1683 , HOH B:1918 , HOH B:1968binding site for residue MG B 1408
17AD8SOFTWAREILE B:1168 , MET B:1169 , ARG B:1171 , SER B:1172 , HOH B:1612 , HOH B:1748binding site for residue EDO B 1409
18AD9SOFTWAREVAL B:1139 , GLY B:1165 , THR B:1167 , HOH B:1795 , HOH B:1826binding site for residue EDO B 1410
19AE1SOFTWAREG A:19 , C A:20 , TYR B:136 , ARG B:139 , HIS B:160 , ASN B:407 , HIS B:415 , HOH B:1506binding site for residue EDO B 1411

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5B2R)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5B2R)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5B2R)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5B2R)

(-) Exons   (0, 0)

(no "Exon" information available for 5B2R)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:RNA  Length:81
                                                                                                                  
                5b2r A    1 GGAAAUUAGGUGCGCUUGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUG   81
                                    10        20        30        40        50        60        70        80 


Chain B from PDB  Type:PROTEIN  Length:1319
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..eeeeee...eeeeeee.......eeeeeeee.....eeeee.eeeee......hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhh...hhhhh.........hhhhhhhhhhhh.hhhhhhhhhhhh....hhhhhhhhhhhhhhh...............hhhhhhhhhhhh..........hhhhhhh...hhhhhhhhhhhh.......hhhhhhhhhhhh......................hhhhhhhhhhhhhh..hhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhh...hhhhhhhhhhhhhhhh..hhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhh..............................hhhhhhhhhhhhhhhhhh.................hhhhhhhhhhhhhh..eee.......ee.hhhhhhhhhhhh.......hhhhhhhhh..........eee.........hhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhh........hhhhhhhh......hhhhhhhh...hhhhhhhhhh.hhhhhhhh...hhhhhhhhhhhhhhhhhhhhhh......eeeeee...hhhhhhhhhhhhhhhh.hhhhhh....hhhhhhhhhhhhhh...........hhhhhhhheeee..........hhh.eeee.hhhhhh......hhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhh..hhhhhhhhhhhhhh..hhhhhhhhhhhhhhhh.............eeee.hhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhhhhhh..hhhhhh...hhhhhhhhhhhhhhhh.eee.....eee...eee......eeee..hhhhhhhhhhh....eeee..............................hhhhhh......eeeeeeeeeeeee....eeeeeeeeeeee..hhhhhhhhhhhhhhhhh....hhhhheee....eee.hhh.eeee.....eee......hhhhhhhhhhhhh...hhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhh......eee..eee.......hhhhhh.eeeee......eeeee.hhh. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                5b2r B    4 KYSIGLAIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRILYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIEEFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDAIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFVSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKQYRSTKEVLDATLIHQSITGLYETRIDLSQLG 1366
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173    || 188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338       348       358       368       378       388       398       408       418       428       438       448       458       468       478       488       498       508       518       528       538       548       558       568       578       588       598       608       618       628       638       648       658       668       678       688       698       708   ||  723       733       743       753       763 ||    783       793       803       813       823       833       843       853       863       873       883       893       903       913       923       933       943       953       963       973       983       993      1003      1032      1042      1052      1062      1072      1082      1092      1102      1112      1122      1132      1142      1152      1162      1172      1182      1192      1202      1212      1222      1232      1242||    1257      1267      1277      1287      1297      1307      1317      1327      1337      1347      1357         
                                                                                                                                                                                                        178|                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             712|                                            765|                                                                                                                                                                                                                                       1011|                                                                                                                                                                                                                1243|                                                                                                                     
                                                                                                                                                                                                         184                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              718                                             776                                                                                                                                                                                                                                        1031                                                                                                                                                                                                                 1249                                                                                                                     


Chain C from PDB  Type:DNA  Length:28
                                                             
                5b2r C    1 CAATCTCAGCCAAGCGCACCTAATTTCC   28
                                    10        20        


Chain D from PDB  Type:DNA  Length:8
                                         
                5b2r D    5 TGAGATTG   12
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5B2R)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5B2R)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5B2R)

(-) Gene Ontology  (12, 12)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ACT  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    K  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
    AE1  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5b2r)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5b2r
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CAS9_STRP1 | Q99ZW2
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  CAS9_STRP1 | Q99ZW2
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        CAS9_STRP1 | Q99ZW2: 4cmp 4cmq 4oo8 4un3 4un4 4un5 4zt0 4zt9 5b2s 5b2t 5f9r 5fq5 5fw1 5fw2 5fw3 5vw1 5xbl

(-) Related Entries Specified in the PDB File

5b2s 5b2t