Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)

(-) Description

Title :  VIBRIO VULNIFICUS ADENINE RIBOSWITCH APTAMER DOMAIN, SYNTHESIZED BY POSITION-SELECTIVE LABELING OF RNA (PLOR), IN COMPLEX WITH ADENINE
 
Authors :  J. Zhang, Y. Liu, Y. -X. Wang, A. R. Ferre-D'Amare
Date :  16 Jan 15  (Deposition) - 06 May 15  (Release) - 01 Jul 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.21
Chains :  Asym. Unit :  X
Biol. Unit 1:  X  (1x)
Keywords :  Rna, Riboswitch (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  Y. Liu, E. Holmstrom, J. Zhang, P. Yu, J. Wang, M. A. Dyba, D. Chen, J. Ying, S. Lockett, D. J. Nesbitt, A. R. Ferre-D'Amare, R. Sousa, J. R. Stagno, Y. X. Wang
Synthesis And Applications Of Rnas With Position-Selective Labelling And Mosaic Composition.
Nature V. 522 368 2015
PubMed-ID: 25938715  |  Reference-DOI: 10.1038/NATURE14352

(-) Compounds

Molecule 1 - VIBRIO VULNIFICUS ADENINE RIBOSWITCH
    Chains: X
    Engineered: YES
    Organism Scientific: VIBRIO VULNIFICUS
    Organism Taxid: 672
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1
Asymmetric Unit : X
Biological Unit 1 (1x): X

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 7)

Asymmetric Unit (2, 7)
No.NameCountTypeFull Name
1ADE1Ligand/IonADENINE
2MG6Ligand/IonMAGNESIUM ION
Biological Unit 1 (1, 1)
No.NameCountTypeFull Name
1ADE1Ligand/IonADENINE
2MG-1Ligand/IonMAGNESIUM ION

(-) Sites  (7, 7)

Asymmetric Unit (7, 7)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREA X:21 , U X:22 , U X:47 , U X:51 , A X:52 , A X:73 , U X:74 , U X:75 , MG X:104binding site for residue ADE X 101
2AC2SOFTWAREHOH X:224 , HOH X:238 , HOH X:243binding site for residue MG X 102
3AC3SOFTWAREA X:24 , HOH X:225 , HOH X:226 , HOH X:227 , HOH X:228 , HOH X:260binding site for residue MG X 103
4AC4SOFTWAREA X:21 , U X:47 , U X:49 , C X:50 , ADE X:101binding site for residue MG X 104
5AC5SOFTWAREHOH X:229 , HOH X:230 , HOH X:231 , HOH X:257binding site for residue MG X 105
6AC6SOFTWAREA X:23 , HOH X:223 , HOH X:237 , HOH X:244 , HOH X:255binding site for residue MG X 106
7AC7SOFTWAREHOH X:207 , HOH X:208 , HOH X:210 , HOH X:217 , HOH X:218 , HOH X:219binding site for residue MG X 107

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4XNR)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4XNR)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4XNR)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4XNR)

(-) Exons   (0, 0)

(no "Exon" information available for 4XNR)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain X from PDB  Type:RNA  Length:71
                                                                                                      
                  4xnr X 13 GGGAAGAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUCUUCCC 83
                                    22        32        42        52        62        72        82
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4XNR)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4XNR)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4XNR)

(-) Gene Ontology  (0, 0)

Asymmetric Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4XNR)

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ADE  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4xnr)
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Asym. Unit - sites PNG format | Biol. Unit 1 PNG format | Biol. Unit 1 - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4xnr
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4XNR)

(-) Related Entries Specified in the PDB File

4xl0