Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  FUNCTIONAL CONSERVATION DESPITE STRUCTURAL DIVERGENCE IN LIGAND-RESPONSIVE RNA SWITCHES
 
Authors :  M. A. Boerneke, S. M. Dibrov, T. H. Hermann
Date :  07 May 14  (Deposition) - 18 Feb 15  (Release) - 18 Feb 15  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.10
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Viral Genome, Internal Ribosome Entry Site, Translation, Rna (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  M. A. Boerneke, S. M. Dibrov, J. Gu, D. L. Wyles, T. Hermann
Functional Conservation Despite Structural Divergence In Ligand-Responsive Rna Switches.
Proc. Natl. Acad. Sci. Usa V. 111 15952 2014
PubMed-ID: 25349403  |  Reference-DOI: 10.1073/PNAS.1414678111

(-) Compounds

Molecule 1 - RNA (26-MER)
    ChainsA
    EngineeredYES
    Organism ScientificSENECA VALLEY VIRUS
    Organism Taxid390157
    SyntheticYES
 
Molecule 2 - RNA (5'- R(*GP*CP*AP*GP*GP*AP*AP*CP*CP*GP*AP*GP*AP*GP*GP*CP*AP*CP*GP*C)-3')
    ChainsB
    EngineeredYES
    Organism ScientificSENECA VALLEY VIRUS
    Organism Taxid390157
    SyntheticYES

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 4)

Asymmetric/Biological Unit (2, 4)
No.NameCountTypeFull Name
1ACT2Ligand/IonACETATE ION
2MG2Ligand/IonMAGNESIUM ION

(-) Sites  (3, 3)

Asymmetric Unit (3, 3)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREG B:45binding site for residue MG B 101
2AC2SOFTWAREU A:19 , C A:20 , G B:30 , G B:31binding site for residue ACT B 102
3AC3SOFTWAREG B:36binding site for residue ACT B 103

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 4PHY)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 4PHY)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 4PHY)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 4PHY)

(-) Exons   (0, 0)

(no "Exon" information available for 4PHY)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:26
                                                         
                  4phy A  1 CGUGCUCCCCACCUCGGAUCACUGCG 26
                                    10        20      

Chain B from PDB  Type:RNA  Length:20
                                                   
                  4phy B 27 GCAGGAACCGAGAGGCACGC 46
                                    36        46

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 4PHY)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 4PHY)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 4PHY)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 4PHY)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    ACT  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 4phy)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  4phy
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 4PHY)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 4PHY)