2AWR - JenaLib

Theor.Model - manually (Jmol Viewer)

Theoretical Model (Jmol Viewer)

Title :   PROTAMINE-DNA COMPLEX 1

Authors :   K. Biegeleisen

Date :   02 Sep 05 (Deposition) - 27 Sep 05 (Release) - 01 Aug 06 (Revision)

Method :   THEORETICAL MODEL

Resolution :   NOT APPLICABLE

Chains :   Theor. Model : A,B,C,D,E,F,G,H

Keywords :   Dna, Helix, Non-Helical, Topology, Topological, Topologically- Linked, Topologically Non-Linked, Side-By-Side, Straight Ladder, Tertiary Structure (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )

Reference :   K. Biegeleisen
The Probable Structure Of The Protamine-Dna Complex.
J. Theor. Biol. V. 241 533 2006
PubMed: search
(for further references see the PDB file header)

Molecule 1 - SPERM PROTAMINE P1
	Chains	:	A
	Organism Common	:	HUMAN
	Organism Scientific	:	HOMO SAPIENS
	Synonym	:	CYSTEINE-RICH PROTAMINE

Molecule 2 - SPERM PROTAMINE P2
	Chains	:	B
	Organism Common	:	HUMAN
	Organism Scientific	:	HOMO SAPIENS
	Synonym	:	HISTONE P2, HP2, PROTAMINE P3, HP3, PROTAMINE P4, HP4, BASIC NUCLEAR PROTEIN HPS1, BASIC NUCLEAR PROTEIN HPS2, HPI1, HPI2

Molecule 3 - 30-MER
	Chains	:	C
	Engineered	:	YES
	Synthetic	:	YES

Molecule 4 - 30-MER
	Chains	:	D
	Engineered	:	YES
	Synthetic	:	YES

Molecule 5 - 29-MER
	Chains	:	E, G
	Engineered	:	YES
	Synthetic	:	YES

Molecule 6 - 29-MER
	Chains	:	F, H
	Engineered	:	YES
	Synthetic	:	YES


Theoretical Model	:

Summary Information (see also Sequences/Alignments below)

(no "Ligand,Modified Residues,Ions" information available for 2AWR)

(no "Site" information available for 2AWR)

Theoretical Model

No.	Residues
1	A:6	-	B:13
2	A:30	-	B:37
3	A:40	-	B:47

(no "Cis Peptide Bond" information available for 2AWR)

(no "SAP(SNP)/Variant" information available for 2AWR)

Theoretical Model (1, 1)

	PROSITE			UniProtKB		PDB
No.	ID	AC	Description	ID	Location	Count	Location
1	PROTAMINE_P1	PS00048	Protamine P1 signature.	HSP1_HUMAN	2-13	1	A:2-13

Theoretical Model (4, 4)

	ENSEMBL					UniProtKB			PDB
No.	Transcript ID	Exon	Exon ID	Genome Location	Length	ID	Location	Length	Count	Location	Length
1.1	ENST00000241808	1	ENSE00001229747	chr16:11370337-11369957	381	PRM2_HUMAN	1-91	91	1	B:1-46	46
1.2b	ENST00000241808	2b	ENSE00000829662	chr16:11369794-11369493	302	PRM2_HUMAN	91-102	12	1	B:46-57	12

2.1	ENST00000312511	1	ENSE00001203463	chr16:11375207-11374984	224	HSP1_HUMAN	1-38	38	1	A:1-38	38
2.2	ENST00000312511	2	ENSE00001203456	chr16:11374892-11374693	200	HSP1_HUMAN	38-51	14	1	A:38-51	14

Theoretical Model

Reformat:	Number of residues per line = ('0' or empty: single-line sequence representation)
	Number of residues per labelling interval =
	UniProt sequence: complete aligned part

Show mapping:	SCOP domains	CATH domains	Pfam domains	Secondary structure (by author)
	SAPs(SNPs)	PROSITE motifs	Exons
	(details for a mapped element are shown in a popup box when the mouse pointer rests over it)

Chain A from PDB  Type:PROTEIN  Length:51
 aligned with HSP1_HUMAN | P04553 from UniProtKB/Swiss-Prot  Length:51

    Alignment length:51
                                    10        20        30        40        50 
           HSP1_HUMAN     1 MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH  51
               SCOP domains --------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee......ee. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------- SAPs(SNPs)
                    PROSITE -PROTAMINE_P1-------------------------------------- PROSITE
           Transcript 2 (1) Exon 2.1  PDB: A:1-38 UniProt: 1-38   ------------- Transcript 2 (1)
           Transcript 2 (2) -------------------------------------Exon 2.2       Transcript 2 (2)
                 2awr A   1 MARYRCCRSQSRSRYYRQRQRSRRRRRRSCQTRRRAMRCCRPRYRPRCRRH  51
                                    10        20        30        40        50

Chain B from PDB  Type:PROTEIN  Length:57
 aligned with PRM2_HUMAN | P04554 from UniProtKB/Swiss-Prot  Length:102

    Alignment length:57
                                    55        65        75        85        95       
           PRM2_HUMAN    46 RTHGQSHYRRRHCSRRRLHRIHRRQHRSCRRRKRRSCRHRRRHRRGCRTRKRTCRRH 102
               SCOP domains --------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------- Pfam domains
         Sec.struct. author ........eeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee......ee Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------- PROSITE
           Transcript 1 (1) Exon 1.1  PDB: B:1-46 UniProt: 1-91           ----------- Transcript 1 (1)
           Transcript 1 (2) ---------------------------------------------Exon 1.2b    Transcript 1 (2)
                 2awr B   1 RTHGGSHYRRRHCSRRRLHRIHRRQHRSCRRRKRRSCRHRRRHRRGCRTRKRTCRRH  57
                                    10        20        30        40        50

Chain C from PDB  Type:DNA  Length:30
                                                              
                 2awr C   1 GTACGTACGTACGTACGTACGTACGTACGT  30
                                    10        20        30

Chain D from PDB  Type:DNA  Length:30
                                                              
                 2awr D   1 ACGTACGTACGTACGTACGTACGTACGTAC  30
                                    10        20        30

Chain E from PDB  Type:DNA  Length:29
                                                             
                 2awr E   1 GTACGTACGTACGTACGTACGTACGTACG  29
                                    10        20

Chain F from PDB  Type:DNA  Length:29
                                                             
                 2awr F   1 CGTACGTACGTACGTACGTACGTACGTAC  29
                                    10        20

Chain G from PDB  Type:DNA  Length:29
                                                             
                 2awr G   1 GTACGTACGTACGTACGTACGTACGTACG  29
                                    10        20

Chain H from PDB  Type:DNA  Length:29
                                                             
                 2awr H   1 CGTACGTACGTACGTACGTACGTACGTAC  29
                                    10        20

Legend:		→ Mismatch	(orange background)
	-	→ Gap	(green background, '-', border residues have a numbering label)
		→ Modified Residue	(blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
	x	→ Chemical Group	(purple background, 'x', labelled with number + name, e.g. ACE or NH2)
	extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '\|'

(no "SCOP Domain" information available for 2AWR)

(no "CATH Domain" information available for 2AWR)

(no "Pfam Domain" information available for 2AWR)

Theoretical Model(hide GO term definitions)

Chain A (HSP1_HUMAN | P04553)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
	GO:0006323	DNA packaging	Any process in which DNA and associated proteins are formed into a compact, orderly structure.
	GO:0030154	cell differentiation	The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state.
	GO:0030261	chromosome condensation	The progressive compaction of dispersed interphase chromatin into threadlike chromosomes prior to mitotic or meiotic nuclear division, or during apoptosis, in eukaryotic cells.
	GO:0007275	multicellular organism development	The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult).
	GO:0006997	nucleus organization	A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the nucleus.
	GO:0007286	spermatid development	The process whose specific outcome is the progression of a spermatid over time, from its formation to the mature structure.
	GO:0007283	spermatogenesis	The process of formation of spermatozoa, including spermatocytogenesis and spermiogenesis.
cellular component
	GO:0005694	chromosome	A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information.
	GO:0005654	nucleoplasm	That part of the nuclear content other than the chromosomes or the nucleolus.
	GO:0000786	nucleosome	A complex comprised of DNA wound around a multisubunit core and associated proteins, which forms the primary packing unit of DNA into higher order structures.
	GO:0005634	nucleus	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

Chain B (PRM2_HUMAN | P04554)

molecular function
	GO:0003677	DNA binding	Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
	GO:0006323	DNA packaging	Any process in which DNA and associated proteins are formed into a compact, orderly structure.
	GO:0030154	cell differentiation	The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state.
	GO:0030261	chromosome condensation	The progressive compaction of dispersed interphase chromatin into threadlike chromosomes prior to mitotic or meiotic nuclear division, or during apoptosis, in eukaryotic cells.
	GO:0007275	multicellular organism development	The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult).
	GO:0006997	nucleus organization	A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the nucleus.
	GO:0007286	spermatid development	The process whose specific outcome is the progression of a spermatid over time, from its formation to the mature structure.
	GO:0007283	spermatogenesis	The process of formation of spermatozoa, including spermatocytogenesis and spermiogenesis.
cellular component
	GO:0005694	chromosome	A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information.
	GO:0005654	nucleoplasm	That part of the nuclear content other than the chromosomes or the nucleolus.
	GO:0000786	nucleosome	A complex comprised of DNA wound around a multisubunit core and associated proteins, which forms the primary packing unit of DNA into higher order structures.
	GO:0005634	nucleus	A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

Theoretical Model
	Complete Structure
		Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
		WebMol \| AstexViewer[tm]@PDBe (Java Applets, require no local installation except for Java; loading may be slow)
		STRAP (Java WebStart application, automatic local installation, requires Java; full application with system access!)
		RasMol (require local installation)
		Molscript (VRML) (requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)

	Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 2awr)

	Sites
(no "Sites" information available for 2awr)

	Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2awr)

Jmol
	protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick [ Theoretical Model PNG format ](automatic orientation, automatically generated)
Molscript
	protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick [ mono PDF format \| stereo PDF format ](default orientation, automatically generated)

Access by PDB/NDB ID
	2awr
		Family and Domain Information	:	ProDom \| SYSTERS
		General Structural Information	:	GlycoscienceDB \| MMDB \| NDB \| OCA \| PDB \| PDBe \| PDBj \| PDBsum \| PDBWiki \| PQS \| PROTEOPEDIA
		Orientation in Membranes	:	OPM
		Protein Surface	:	SURFACE
		Secondary Structure	:	DSSP (structure derived) \| HSSP (homology derived)
		Structural Genomics	:	GeneCensus
		Structural Neighbours	:	CE \| VAST
		Structure Classification	:	CATH \| Dali \| SCOP
		Validation and Original Data	:	BMRB Data View \| BMRB Restraints Grid \| EDS \| PROCHECK \| RECOORD \| WHAT_CHECK

Access by UniProt ID/Accession number
	HSP1_HUMAN \| P04553
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt
	PRM2_HUMAN \| P04554
		Comparative Protein Structure Models	:	ModBase
		Genomic Information	:	Ensembl
		Protein-protein Interaction	:	DIP
		Sequence, Family and Domain Information	:	InterPro \| Pfam \| SMART \| UniProtKB/SwissProt

Access by Enzyme Classificator (EC Number)
	(no 'Enzyme Classificator' available)
		General Enzyme Information	:	BRENDA \| EC-PDB \| Enzyme \| IntEnz
		Pathway	:	KEGG \| MetaCyc

Access by Disease Identifier (MIM ID)
	(no 'MIM ID' available)
		Disease Information	:	OMIM

Access by GenAge ID
	(no 'GenAge ID' available)
		Age Related Information	:	GenAge

Access by PDB/NDB ID
		Domain Information	:	XDom
		Interatomic Contacts of Structural Units	:	CSU
		Ligand-protein Contacts	:	LPC
		Protein Cavities	:	castP
		Sequence and Secondary Structure	:	PDBCartoon
		Structure Alignment	:	STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
		Structure and Sequence Browser	:	STING

Access by UniProt ID/Accession number
	HSP1_HUMAN \| P04553
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)
	PRM2_HUMAN \| P04554
		Protein Disorder Prediction	:	DisEMBL \| FoldIndex \| GLOBPLOT (for more information see DisProt)

(no "Entries Sharing at Least One Protein Chain" available for 2AWR)

Description

Compounds

Structural Features

Chains, Units

Ligands, Modified Residues, Ions (0, 0)

Sites (0, 0)

SS Bonds (3, 3)

Cis Peptide Bonds (0, 0)

Sequence-Structure Mapping

SAPs(SNPs)/Variants (0, 0)

PROSITE Motifs (1, 1)

Exons (4, 4)

Sequences/Alignments

Classification and Annotation

SCOP Domains (0, 0)

CATH Domains (0, 0)

Pfam Domains (0, 0)

Gene Ontology (12, 24)

Visualization

Interactive Views

Still Images

Databases and Analysis Tools

Databases

Analysis Tools

Related Entries

Entries Sharing at Least One Protein Chain (UniProt ID)

Related Entries Specified in the PDB File