Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  COMPLEX STRUCTURE OF CCA-ADDING ENZYME WITH TRNAMINIDCC
 
Authors :  K. Tomita, R. Ishitani, S. Fukai, O. Nureki
Date :  08 Jun 06  (Deposition) - 14 Nov 06  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym./Biol. Unit :  A,B
Keywords :  Protein-Rna Complex, Transferase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  K. Tomita, R. Ishitani, S. Fukai, O. Nureki
Complete Crystallographic Analysis Of The Dynamics Of Cca Sequence Addition
Nature V. 443 956 2006
PubMed-ID: 17051158  |  Reference-DOI: 10.1038/NATURE05204
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - TRNA (34-MER)
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 2 - CCA-ADDING ENZYME
    ChainsA
    EC Number2.7.7.25, 2.7.7.21
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificARCHAEOGLOBUS FULGIDUS
    Organism Taxid2234
    SynonymTRNA NUCLEOTIDYLTRANSFERASE, TRNA ADENYLYL- /CYTIDYLYL- TRANSFERASE, TRNA CCA-PYROPHOSPHORYLASE, TRNA- NT

 Structural Features

(-) Chains, Units

  12
Asymmetric/Biological Unit AB

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric/Biological Unit (1, 2)
No.NameCountTypeFull Name
1SO42Ligand/IonSULFATE ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWARESER A:47 , THR A:52 , TRP A:53 , LEU A:54 , SER A:57 , LYS A:152 , TYR A:161 , HOH A:1046BINDING SITE FOR RESIDUE SO4 A 1001
2AC2SOFTWAREARG A:299 , ARG A:302 , LYS A:303BINDING SITE FOR RESIDUE SO4 A 1002

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 2DR9)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 2DR9)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 2DR9)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 2DR9)

(-) Exons   (0, 0)

(no "Exon" information available for 2DR9)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:437
 aligned with CCA_ARCFU | O28126 from UniProtKB/Swiss-Prot  Length:437

    Alignment length:437
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       
            CCA_ARCFU     1 MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKD 437
               SCOP domains d2dr9a2 A:1-142 tRNA nucleotidyltransferase, N-terminal domain                                                                                d2dr9a1 A:143-257 tRNA nucleotidyltransferase, second domain                                                       d2dr9a3 A:258-437 tRNA nucleotidyltransferase, C-terminal domain                                                                                                                     SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhh..eeeehhhhh.........eeeeeeee...hhhhhhhhhhhhhhhhh.eee........eeeee..eeeeeeeeee............hhhhhhhhhhhhhh.hhhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhhh.....eeee....eeee....eee.............hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhh.eeeeeeee....hhhhhhhhhhhhhhhhhhhhhhh...eeeeeeee...eeeeeeee.......eeeeeeee..hhhhhhhhhhh......eee..eeeeeee....hhhhhhhhhhhhhh...hhhhhhhhhhh.eeehhhhhhh..hhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 2dr9 A   1 MKVEEILEKALELVIPDEEEVRKGREAEEELRRRLDELGVEYVFVGSYARNTWLKGSLEIDVFLLFPEEFSKEELRERGLEIGKAVLDSYEIRYAEHPYVHGVVKGVEVDVVPCYKLKEPKNIKSAVDRTPFHHKWLEGRIKGKENEVRLLKGFLKANGIYGAEYKVRGFSGYLCELLIVFYGSFLETVKNARRWTRRTVIDVAKGEVRKGEEFFVVDPVDEKRNVAANLSLDNLARFVHLCREFMEAPSLGFFKPKHPLEIEPERLRKIVEERGTAVFAVKFRKPDIVDDNLYPQLERASRKIFEFLERENFMPLRSAFKASEEFCYLLFECQIKEISRVFRRMGPQFEDERNVKKFLSRNRAFRPFIENGRWWAFEMRKFTTPEEGVRSYASTHWHTLGKNVGESIREYFEIISGEKLFKEPVTAELCEMMGVKD 437
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       

Chain B from PDB  Type:RNA  Length:34
                                                                  
                 2dr9 B   1 GGCCCGGGGCGGUUCGAUUCCGCCCUGGGCCACC  34
                                    10        20        30    

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (3, 3)

Asymmetric/Biological Unit

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 2DR9)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 2DR9)

(-) Gene Ontology  (17, 17)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (CCA_ARCFU | O28126)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0052929    ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity    Catalysis of the reaction: a tRNA with a 3' CC end + ATP = a tRNA with a 3' CCA end + diphosphate.
    GO:0052928    CTP:3'-cytidine-tRNA cytidylyltransferase activity    Catalysis of the reaction: a tRNA with a 3' cytidine + CTP = a tRNA with a 3' CC end + diphosphate.
    GO:0052927    CTP:tRNA cytidylyltransferase activity    Catalysis of the reaction: a tRNA precursor + CTP = a tRNA with a 3' cytidine end + diphosphate.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0000287    magnesium ion binding    Interacting selectively and non-covalently with magnesium (Mg) ions.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0004810    tRNA adenylyltransferase activity    Catalysis of the reaction: ATP + tRNA(n) = diphosphate + tRNA(n+1).
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
    GO:0016437    tRNA cytidylyltransferase activity    Catalysis of the reaction: CTP + tRNA(n) = diphosphate + tRNA(n+1).
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0031123    RNA 3'-end processing    Any process involved in forming the mature 3' end of an RNA molecule.
    GO:0042245    RNA repair    Any process that results in the repair of damaged RNA.
    GO:0001680    tRNA 3'-terminal CCA addition    Post-transcriptional addition of the terminal 3' CCA sequence to a tRNA which does not encode this sequence within the primary transcript. CCA addition proceeds by the sequential addition of CTP, CTP, and then ATP to the 3' end of the tRNA, yielding a diphosphate with each nucleotide addition.
    GO:0008033    tRNA processing    The process in which a pre-tRNA molecule is converted to a mature tRNA, ready for addition of an aminoacyl group.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    SO4  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 2dr9)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  2dr9
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CCA_ARCFU | O28126
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  2.7.7.21
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  2.7.7.25
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  CCA_ARCFU | O28126
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        CCA_ARCFU | O281261r89 1r8a 1r8b 1r8c 1sz1 1tfw 1tfy 1uet 1ueu 1uev 2dr5 2dr7 2dr8 2dra 2drb 2dvi 2zh1 2zh2 2zh3 2zh4 2zh5 2zh6 2zh7 2zh8 2zh9 2zha 2zhb 3ouy 3ov7 3ova 3ovb 3ovs 4x4n 4x4o 4x4p 4x4q 4x4r 4x4s 4x4t 4x4u 4x4v

(-) Related Entries Specified in the PDB File

2dr5 2dr7 2dr8 2dra 2drb