Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Theor.Model - manually
(-)Theoretical Model
collapse expand < >
Image Theor.Model - manually
Theor.Model - manually  (Jmol Viewer)
Image Theoretical Model
Theoretical Model  (Jmol Viewer)

(-) Description

Title :  A THREE-DIMENSIONAL MODEL OF THE REV BINDING ELEMENT OF HIV-1 DERIVED FROM ANALYSES OF IN VITRO SELECTED VARIANTS
 
Authors :  F. Leclerc, R. J. Cedergren, A. D. Ellington
Date :  05 Apr 94  (Deposition) - 15 Oct 94  (Release) - 01 Apr 03  (Revision)
Method :  THEORETICAL MODEL
Resolution :  NOT APPLICABLE
Chains :  Theor. Model :  A,B
Keywords :  Rna/Transcription Regulation Protein (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  F. Leclerc, R. Cedergren, A. D. Ellington
A Three-Dimensional Model Of The Rev-Binding Element Of Hiv-1 Derived From Analyses Of Aptamers.
Nat. Struct. Biol. V. 1 293 1994
PubMed: search
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - RNA (30-MER)
    ChainsA
    EngineeredYES
    SyntheticYES
 
Molecule 2 - 
    ChainsB
    EngineeredYES

 Structural Features

(-) Chains, Units

  
Theoretical Model 

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 262D)

(-) Sites  (0, 0)

(no "Site" information available for 262D)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 262D)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 262D)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 262D)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 262D)

(-) Exons   (0, 0)

(no "Exon" information available for 262D)

(-) Sequences/Alignments

Theoretical Model
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:30
                                                             
                  262d A 43 GGUGGGCGCAGCUUCGGCUGACGGUACACC 77
                                    52     || 67        77
                                          58|             
                                           64             

Chain B from PDB  Type:PROTEIN  Length:17
 aligned with REV_HV1B8 | P05864 from UniProtKB/Swiss-Prot  Length:106

    Alignment length:17
                                    33       
             REV_HV1B8   24 TRQARRNRRRRWRERQR 40
               SCOP domains ----------------- SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains ----------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                  262d B  1 TRQARRNRRRRWRERQR 17
                                    10       

Chain B from PDB  Type:PROTEIN  Length:17
 aligned with REV_HV1SC | P05872 from UniProtKB/Swiss-Prot  Length:116

    Alignment length:17
                                    43       
             REV_HV1SC   34 TRQARRNRRRRWRERQR 50
               SCOP domains ----------------- SCOP domains
               CATH domains ----------------- CATH domains
               Pfam domains ----------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------- SAPs(SNPs)
                    PROSITE ----------------- PROSITE
                 Transcript ----------------- Transcript
                  262d B  1 TRQARRNRRRRWRERQR 17
                                    10       

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 262D)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 262D)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 262D)

(-) Gene Ontology  (9, 18)

Theoretical Model(hide GO term definitions)
Chain B   (REV_HV1B8 | P05864)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0051028    mRNA transport    The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

Chain B   (REV_HV1SC | P05872)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0051028    mRNA transport    The directed movement of mRNA, messenger ribonucleic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
    GO:0030430    host cell cytoplasm    The cytoplasm of a host cell.
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

 Visualization

(-) Interactive Views

Theoretical Model
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 262d)
 
  Sites
(no "Sites" information available for 262d)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 262d)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
Insightii
  RNA: ribbon, balls and sticks; protein: spacefill
Midas
  RNA: ribbon, plates; protein: ribbon
  spacefill
Distance Plot
  representative atoms: CA, O3'

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  262d
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  REV_HV1B8 | P05864
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
  REV_HV1SC | P05872
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  REV_HV1B8 | P05864
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  REV_HV1SC | P05872
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        REV_HV1B8 | P05864163d
        REV_HV1SC | P05872163d

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 262D)