Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)NMR Structure - manually
(-)NMR Structure - model 1
(-)NMR Structure - all models
collapse expand < >
Image NMR Structure - manually
NMR Structure - manually  (Jmol Viewer)
Image NMR Structure - model 1
NMR Structure - model 1  (Jmol Viewer)
Image NMR Structure - all models
NMR Structure - all models  (Jmol Viewer)

(-) Description

Title :  BIV TAT PEPTIDE (RESIDUES 68-81), NMR, MINIMIZED AVERAGE STRUCTURE
 
Authors :  J. D. Puglisi, L. Chen, S. Blanchard, A. D. Frankel
Date :  25 Jul 96  (Deposition) - 27 Jan 97  (Release) - 24 Feb 09  (Revision)
Method :  SOLUTION NMR
Resolution :  NOT APPLICABLE
Chains :  NMR Structure  :  A,B
Keywords :  Complex (Regulatory Protein/Rna), Transcription Regulation, Viral Protein/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  J. D. Puglisi, L. Chen, S. Blanchard, A. D. Frankel
Solution Structure Of A Bovine Immunodeficiency Virus Tat-Tar Peptide-Rna Complex.
Science V. 270 1200 1995
PubMed-ID: 7502045
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - BIV TAR RNA
    Chains: B
    Engineered: YES
    Fragment: RESIDUES 4 - 32
    Synthetic: YES
 
Molecule 2 - BIV TAT PEPTIDE
    Chains: A
    Engineered: YES
    Fragment: RESIDUES 68 - 81

 Structural Features

(-) Chains, Units

  
NMR Structure : 

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1MNB)

(-) Sites  (0, 0)

(no "Site" information available for 1MNB)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1MNB)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1MNB)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (1, 1)

NMR Structure (1, 1)
  dbSNPPDB
No.SourceVariant IDVariantUniProt IDStatusIDChainVariant
1UniProtVAR_TAT_BIV29_004 *R69PTAT_BIV29  ---  ---AP2P
   * ID not provided by source
  SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1MNB)

(-) Exons   (0, 0)

(no "Exon" information available for 1MNB)

(-) Sequences/Alignments

NMR Structure
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:14
 aligned with TAT_BIV29 | P19564 from UniProtKB/Swiss-Prot  Length:103

    Alignment length:14
                                    77    
             TAT_BIV29   68 RRRGTRGKGRRIRR 81
               SCOP domains d1mnba_ A:     SCOP domains
               CATH domains -------------- CATH domains
               Pfam domains -------------- Pfam domains
         Sec.struct. author .............. Sec.struct. author
                 SAPs(SNPs) -P------------ SAPs(SNPs)
                    PROSITE -------------- PROSITE
                 Transcript -------------- Transcript
                  1mnb A  1 RPRGTRGKGRRIRR 14
                                    10    


Chain B from PDB  Type:RNA  Length:28
                                                           
                  1mnb B  1 GGCUCGUGUAGCUCAUUAGCUCCGAGCC 28
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 1)

NMR Structure
(-)
Class: Peptides (792)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1MNB)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1MNB)

(-) Gene Ontology  (7, 7)

NMR Structure(hide GO term definitions)
Chain A   (TAT_BIV29 | P19564)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
    GO:0016032    viral process    A multi-organism process in which a virus is a participant. The other participant is the host. Includes infection of a host cell, replication of the viral genome, and assembly of progeny virus particles. In some cases the viral genetic material may integrate into the host genome and only subsequently, under particular circumstances, 'complete' its life cycle.
cellular component
    GO:0044196    host cell nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic host cells.
    GO:0042025    host cell nucleus    A membrane-bounded organelle as it is found in the host cell in which chromosomes are housed and replicated. The host is defined as the larger of the organisms involved in a symbiotic interaction.

 Visualization

(-) Interactive Views

NMR Structure
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1mnb)
 
  Sites
(no "Sites" information available for 1mnb)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1mnb)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ NMR Structure - model 1 PNG format | NMR Structure - all models PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)
Nsightii
  ribbon
[ stereo GIF format | mono GIF format | stereo GIF format ]
  RNA: spacefill; peptide: ribbon, sticks
[ mono GIF format | stereo GIF format ]
  RNA: sticks: peptide: spacefill; detailed view of the peptide/RNA interaction region
[ mono GIF format | stereo GIF format ]
Weblab
  ribbon, labeling
[ mono GIF format | stereo GIF format ]
  spacefill
[ mono GIF format | stereo GIF format ]
  surface, molecular electrostatic potential coloring
[ mono GIF format | stereo GIF format ]

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1mnb
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TAT_BIV29 | P19564
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  TAT_BIV29 | P19564
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TAT_BIV29 | P19564: 1biv

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1MNB)