Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Biological Unit 1
(-)Biological Unit 2
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Title :  GLUTAMYL-TRNA SYNTHETASE COMPLEXED WITH TRNA(GLU).
 
Authors :  S. Sekine, O. Nureki, A. Shimada, D. G. Vassylyev, S. Yokoyama, Riken Structural Genomics/Proteomics Initiative (Rsgi)
Date :  31 Oct 00  (Deposition) - 01 Sep 01  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.40
Chains :  Asym. Unit :  A,B,C,D
Biol. Unit 1:  A,B  (1x)
Biol. Unit 2:  C,D  (1x)
Keywords :  Aminoacyl-Trna Synthetase, Protein-Rna Complex, Transfer Rna, Riken Structural Genomics/Proteomics Initiative, Rsgi, Structural Genomics, Ligase/Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  S. Sekine, O. Nureki, A. Shimada, D. G. Vassylyev, S. Yokoyama
Structural Basis For Anticodon Recognition By Discriminating Glutamyl-Trna Synthetase.
Nat. Struct. Biol. V. 8 203 2001
PubMed-ID: 11224561  |  Reference-DOI: 10.1038/84927
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - TRNA(GLU)
    Chains: B, D
    Engineered: YES
    Synthetic: YES
 
Molecule 2 - GLUTAMYL-TRNA SYNTHETASE
    Chains: A, C
    EC Number: 6.1.1.17
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PK7
    Expression System Taxid: 562
    Expression System Vector Type: PLASMID
    Organism Scientific: THERMUS THERMOPHILUS
    Organism Taxid: 274

 Structural Features

(-) Chains, Units

  1234
Asymmetric Unit : ABCD
Biological Unit 1 (1x): AB  
Biological Unit 2 (1x):   CD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1G59)

(-) Sites  (0, 0)

(no "Site" information available for 1G59)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1G59)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1G59)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1G59)

(-) PROSITE Motifs  (1, 2)

Asymmetric Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYE_THET88-19
 		  2A:8-19
C:8-19
Biological Unit 1 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYE_THET88-19
 		  1A:8-19
-
Biological Unit 2 (1, 1)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1AA_TRNA_LIGASE_IPS00178 Aminoacyl-transfer RNA synthetases class-I signature.SYE_THET88-19
 		  1-
C:8-19

(-) Exons   (0, 0)

(no "Exon" information available for 1G59)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:468
 aligned with SYE_THET8 | P27000 from UniProtKB/Swiss-Prot  Length:468

    Alignment length:468
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460        
            SYE_THET8     1 MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVGGPHGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA 468
               SCOP domains d1g59a2 A:1-305 Glutamyl-tRNA synthetase (GluRS)                                                                                                                                                                                                                                                                 d1g59a1 A:306-468 C-terminal domain of glutamyl-tRNA synthetase (GluRS)                                                                                             SCOP domains
               CATH domains 1g59A01 A:1-70,A:187-237                                              1g59A03 A:71-186 Glutamyl-tRNA Synthetase; Domain 3                                                                 1g59A01 A:1-70,A:187-237                           1g59A02 A:238-322 Glutamyl-trna Synthetase; Domain 2                                 1g59A04 A:323-370                               1g59A05 A:371-468  [code=1.10.10.350, no name defined]                                             CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..eeee........hhhhhhhhhhhhhhhhhh..eeee............hhhhhhhhhhhhh..................hhhhhhhhhhhhhhhhh...eeee..hhhhhhhhhhhh....hhhhhhhhhhhhhhhhh....eeee......eeeeee...eeeeee.hhh...eee......hhhhhhhhhhhhh...eeeee.hhh.hhhhhhhhhhhh.....eeeee..................hhhhhhhh..hhhhhhhhhhhh...........hhhhhhhhhhhhh........hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh...hhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhh...hhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE -------AA_TRNA_LIGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 1g59 A   1 MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVAAPTGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA 468
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460        


Chain B from PDB  Type:RNA  Length:75
                                                                                                           
                 1g59 B 501 GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA 576
                                   510       520       530       540     ||551       561       571     
                                                                       546|                            
                                                                        548                            


Chain C from PDB  Type:PROTEIN  Length:468
 aligned with SYE_THET8 | P27000 from UniProtKB/Swiss-Prot  Length:468

    Alignment length:468
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460        
            SYE_THET8     1 MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVGGPHGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA 468
               SCOP domains d1g59c2 C:1-305 Glutamyl-tRNA synthetase (GluRS)                                                                                                                                                                                                                                                                 d1g59c1 C:306-468 C-terminal domain of glutamyl-tRNA synthetase (GluRS)                                                                                             SCOP domains
               CATH domains 1g59C01 C:1-70,C:187-237                                              1g59C03 C:71-186 Glutamyl-tRNA Synthetase; Domain 3                                                                 1g59C01 C:1-70,C:187-237                           1g59C02 C:238-322 Glutamyl-trna Synthetase; Domain 2                                 1g59C04 C:323-370                               1g59C05 C:371-468  [code=1.10.10.350, no name defined]                                             CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..eeee........hhhhhhhhhhhhhhhhhh..eeee.....hhhhh...hhhhhhhhhhhh.....................hhhhhhhhhhhhhh...eeee..hhhhhhhhhhhh....hhhhhhhhhhhhhhhhh....eeee......eeeeee...eeeeee.hhh...eee......hhhhhhhhhhhhh...eeeee.hhh.hhhhhhhhhhhh.....eeeee..................hhhhhhhh..hhhhhhhhhhhh...........hhhhhhhhhhhhh........hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh...hhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhh..hhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE -------AA_TRNA_LIGA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 1g59 C   1 MVVTRIAPSPTGDPHVGTAYIALFNYAWARRNGGRFIVRIEDTDRARYVPGAEERILAALKWLGLSYDEGPDVAAPTGPYRQSERLPLYQKYAEELLKRGWAYRAFETPEELEQIRKEKGGYDGRARNIPPEEAEERARRGEPHVIRLKVPRPGTTEVKDELRGVVVYDNQEIPDVVLLKSDGYPTYHLANVVDDHLMGVTDVIRAEEWLVSTPIHVLLYRAFGWEAPRFYHMPLLRNPDKTKISKRKSHTSLDWYKAEGFLPEALRNYLCLMGFSMPDGREIFTLEEFIQAFTWERVSLGGPVFDLEKLRWMNGKYIREVLSLEEVAERVKPFLREAGLSWESEAYLRRAVELMRPRFDTLKEFPEKARYLFTEDYPVSEKAQRKLEEGLPLLKELYPRLRAQEEWTEAALEALLRGFAAEKGVKLGQVAQPLRAALTGSLETPGLFEILALLGKERALRRLERALA 468
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460        


Chain D from PDB  Type:RNA  Length:75
                                                                                                           
                 1g59 D 501 GGCCCCAUCGUCUAGCGGUUAGGACGCGGCCCUCUCAAGGCCGAAACGGGGGUUCGAUUCCCCCUGGGGUCACCA 576
                                   510       520       530       540     ||551       561       571     
                                                                       546|                            
                                                                        548
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 4)

Asymmetric Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: Alpha and beta proteins (a/b) (23833)

(-) CATH Domains  (5, 10)

Asymmetric Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Alpha (13335)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1G59)

(-) Gene Ontology  (12, 12)

Asymmetric Unit(hide GO term definitions)
Chain A,C   (SYE_THET8 | P27000)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0004818    glutamate-tRNA ligase activity    Catalysis of the reaction: ATP + L-glutamate + tRNA(Glu) = AMP + diphosphate + L-glutamyl-tRNA(Glu).
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0016876    ligase activity, forming aminoacyl-tRNA and related compounds    Catalysis of the joining of an amino acid and a nucleic acid (usually tRNA) or poly(ribitol phosphate), with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate. The reaction forms an aminoacyl-tRNA or a related compound.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
biological process
    GO:0006424    glutamyl-tRNA aminoacylation    The process of coupling glutamate to glutamyl-tRNA, catalyzed by glutamyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'- adenosine residue of the tRNA.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1g59)
 
  Sites
(no "Sites" information available for 1g59)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1g59)
 
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Biol. Unit 1 PNG format | Biol. Unit 2 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1g59
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYE_THET8 | P27000
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.17
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SYE_THET8 | P27000
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYE_THET8 | P27000: 1gln 1j09 1n75 1n77 1n78 2cuz 2cv0 2cv1 2cv2 2dxi

(-) Related Entries Specified in the PDB File

1gln 1GLN IS THE TRNA-FREE STRUCTURE OF THE SAME ENZYME. RELATED ID: TRT001000193.1 RELATED DB: TARGETDB