Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Biological Unit 1
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)

(-) Description

Title :  THE CRYSTAL STRUCTURE OF PHENYLALANYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS COMPLEXED WITH COGNATE TRNAPHE
 
Authors :  Y. Goldgur, L. Mosyak, L. Reshetnikova, V. Ankilova, M. Safro
Date :  29 Feb 00  (Deposition) - 06 Mar 00  (Release) - 13 Jul 11  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.30
Chains :  Asym. Unit :  A,B,C
Biol. Unit 1:  A,B,C  (2x)
Keywords :  Aminoacyl-Trna Synthetase, Trna Recognition, Ligase-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  Y. Goldgur, L. Mosyak, L. Reshetnikova, V. Ankilova, O. Lavrik, S. Khodyreva, M. Safro
The Crystal Structure Of Phenylalanyl-Trna Synthetase From Thermus Thermophilus Complexed With Cognate Trnaphe.
Structure V. 5 59 1997
PubMed-ID: 9016717  |  Reference-DOI: 10.1016/S0969-2126(97)00166-4

(-) Compounds

Molecule 1 - TRNA(PHE)
    Chains: C
    Organism Scientific: THERMUS THERMOPHILUS
    Organism Taxid: 300852
    Strain: HB8
 
Molecule 2 - PHENYLALANYL-TRNA SYNTHETASE
    Chains: A
    EC Number: 6.1.1.20
    Fragment: ALPHA CHAIN
    Organism Scientific: THERMUS THERMOPHILUS
    Organism Taxid: 300852
    Strain: HB8
    Synonym: PHENYLALANINE--TRNA LIGASE ALPHA CHAIN, PHERS
 
Molecule 3 - PHENYLALANYL-TRNA SYNTHETASE
    Chains: B
    EC Number: 6.1.1.20
    Fragment: BETA CHAIN
    Organism Scientific: THERMUS THERMOPHILUS
    Organism Taxid: 300852
    Strain: HB8
    Synonym: PHENYLALANINE--TRNA LIGASE BETA CHAIN, PHERS

 Structural Features

(-) Chains, Units

  123
Asymmetric Unit : ABC
Biological Unit 1 (2x): ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1EIY)

(-) Sites  (0, 0)

(no "Site" information available for 1EIY)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1EIY)

(-) Cis Peptide Bonds  (5, 5)

Asymmetric Unit
No.Residues
1Pro A:192 -Pro A:193
2Glu A:262 -Pro A:263
3Gly B:439 -Pro B:440
4Leu B:675 -Pro B:676
5Pro B:734 -Pro B:735

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1EIY)

(-) PROSITE Motifs  (3, 3)

Asymmetric Unit (3, 3)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1TRBDPS50886 tRNA-binding domain profile.SYFB_THET839-147  1B:39-147
2B5PS51483 B5 domain profile.SYFB_THET8399-474  1B:399-474
3FDX_ACBPS51447 Ferredoxin-fold anticodon binding (FDX-ACB) domain profile.SYFB_THET8688-780  1B:688-780
Biological Unit 1 (3, 6)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1TRBDPS50886 tRNA-binding domain profile.SYFB_THET839-147  2B:39-147
2B5PS51483 B5 domain profile.SYFB_THET8399-474  2B:399-474
3FDX_ACBPS51447 Ferredoxin-fold anticodon binding (FDX-ACB) domain profile.SYFB_THET8688-780  2B:688-780

(-) Exons   (0, 0)

(no "Exon" information available for 1EIY)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:345
 aligned with SYFA_THET8 | Q5SGX2 from UniProtKB/Swiss-Prot  Length:350

    Alignment length:345
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345     
           SYFA_THET8     6 LAAIQNARDLEELKALKARYLGKKGLLTQEMKGLSALPLEERRKRGQELNAIKAALEAALEAREKALEEAALKEALERERVDVSLPGASLFSGGLHPITLMERELVEIFRALGYQAVEGPEVESEFFNFDALNIPEHHPARDMWDTFWLTGEGFRLEGPLGEEVEGRLLLRTHTSPMQVRYMVAHTPPFRIVVPGRVFRFEQTDATHEAVFHQLEGLVVGEGIAMAHLKGAIYELAQALFGPDSKVRFQPVYFPFVEPGAQFAVWWPEGGKWLELGGAGMVHPKVFQAVDAYRERLGLPPAYRGVTGFAFGLGVERLAMLRYGIPDIRYFFGGRLKFLEQFKGVL 350
               SCOP domains d1eiya1 A:6-84 Phenylalanyl-tRNA synthetase (PheRS)                            d1eiya2 A:85-350 Phenyl-tRNA synthetase (PheRS) alpha subunit, PheS                                                                                                                                                                                                        SCOP domains
               CATH domains 1eiyA00 A:6-350 Bira Bifunctional Protein; Domain 2                                                                                                                                                                                                                                                                                                       CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh................hhhhhhhhhhhhhhhh...ee.....eee...............hhhhh....ee.................eee....hhhhhhhhhhh...eeeeeeeeee...........eeeeeeeeeee...hhhhhhhhhhhhhhhhhh....eeeee.....eeeeeeeeee.hhhh.ee..eeeeeehhhhhhhhhhhhhhh.........eeeeeeeehhhhhhhh.....hhhhhh.hhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1eiy A   6 LAAIQNARDLEELKALKARYLGKKGLLTQEMKGLSALPLEERRKRGQELNAIKAALEAALEAREKALEEAALKEALERERVDVSLPGASLFSGGLHPITLMERELVEIFRALGYQAVEGPEVESEFFNFDALNIPEHHPARDMWDTFWLTGEGFRLEGPLGEEVEGRLLLRTHTSPMQVRYMVAHTPPFRIVVPGRVFRFEQTDATHEAVFHQLEGLVVGEGIAMAHLKGAIYELAQALFGPDSKVRFQPVYFPFVEPGAQFAVWWPEGGKWLELGGAGMVHPKVFQAVDAYRERLGLPPAYRGVTGFAFGLGVERLAMLRYGIPDIRYFFGGRLKFLEQFKGVL 350
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345     


Chain A from PDB  Type:PROTEIN  Length:345
 aligned with SYFA_THETH | P27001 from UniProtKB/Swiss-Prot  Length:350

    Alignment length:345
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345     
           SYFA_THETH     6 LAAIQNARDLEELKALKARYLGKKGLLTQEMKGLSALPLEERRKRGQELNAIKAALEAALEAREKALEEAALKEALERERVDVSLPGASLFSGGLHPITLMERELVEIFRALGYQAVEGPEVESEFFNFDALNIPEHHPARDMWDTFWLTGEGFRLEGPLGEEVEGRLLLRTHTSPMQVRYMVAHTPPFRIVVPGRVFRFEQTDATHEAVFHQLEGLVVGEGIAMAHLKGAIYELAQALFGPDSKVRFQPVYFPFVEPGAQFAVWWPEGGKWLELGGAGMVHPKVFQAVDAYRERLGLPPAYRGVTGFAFGLGVERLAMLRYGIPDIRYFFGGRLKFLEQFKGVL 350
               SCOP domains d1eiya1 A:6-84 Phenylalanyl-tRNA synthetase (PheRS)                            d1eiya2 A:85-350 Phenyl-tRNA synthetase (PheRS) alpha subunit, PheS                                                                                                                                                                                                        SCOP domains
               CATH domains 1eiyA00 A:6-350 Bira Bifunctional Protein; Domain 2                                                                                                                                                                                                                                                                                                       CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh................hhhhhhhhhhhhhhhh...ee.....eee...............hhhhh....ee.................eee....hhhhhhhhhhh...eeeeeeeeee...........eeeeeeeeeee...hhhhhhhhhhhhhhhhhh....eeeee.....eeeeeeeeee.hhhh.ee..eeeeeehhhhhhhhhhhhhhh.........eeeeeeeehhhhhhhh.....hhhhhh.hhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1eiy A   6 LAAIQNARDLEELKALKARYLGKKGLLTQEMKGLSALPLEERRKRGQELNAIKAALEAALEAREKALEEAALKEALERERVDVSLPGASLFSGGLHPITLMERELVEIFRALGYQAVEGPEVESEFFNFDALNIPEHHPARDMWDTFWLTGEGFRLEGPLGEEVEGRLLLRTHTSPMQVRYMVAHTPPFRIVVPGRVFRFEQTDATHEAVFHQLEGLVVGEGIAMAHLKGAIYELAQALFGPDSKVRFQPVYFPFVEPGAQFAVWWPEGGKWLELGGAGMVHPKVFQAVDAYRERLGLPPAYRGVTGFAFGLGVERLAMLRYGIPDIRYFFGGRLKFLEQFKGVL 350
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225       235       245       255       265       275       285       295       305       315       325       335       345     


Chain B from PDB  Type:PROTEIN  Length:785
 aligned with SYFB_THET8 | Q5SGX1 from UniProtKB/Swiss-Prot  Length:785

    Alignment length:785
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780     
           SYFB_THET8     1 MRVPFSWLKAYVPELESPEVLEERLAGLGFETDRIERVFPIPRGVVFARVLEAHPIPGTRLKRLVLDAGRTVEVVSGAENARKGIGVALALPGTELPGLGQKVGERVIQGVRSFGMALSPRELGVGEYGGGLLEFPEDALPPGTPLSEAWPEEVVLDLEVTPNRPDALGLLGLARDLHALGYALVEPEAALKAEALPLPFALKVEDPEGAPHFTLGYAFGLRVAPSPLWMQRALFAAGMRPINNVVDVTNYVMLERAQPMHAFDLRFVGEGIAVRRAREGERLKTLDGVERTLHPEDLVIAGWRGEESFPLGLAGVMGGAESEVREDTEAIALEVACFDPVSIRKTARRHGLRTEASHRFERGVDPLGQVPAQRRALSLLQALAGARVAEALLEAGSPKPPEAIPFRPEYANRLLGTSYPEAEQIAILKRLGCRVEGEGPTYRVTPPSHRLDLRLEEDLVEEVARIQGYETIPLALPAFFPAPDNRGVEAPYRKEQRLREVLSGLGFQEVYTYSFMDPEDARRFRLDPPRLLLLNPLAPEKAALRTHLFPGLVRVLKENLDLDRPERALLFEVGRVFREREETHLAGLLFGEGVGLPWAKERLSGYFLLKGYLEALFARLGLAFRVEAQAFPFLHPGVSGRVLVEGEEVGFLGALHPEIAQELELPPVHLFELRLPLPDKPLAFQDPSRHPAAFRDLAVVVPAPTPYGEVEALVREAAGPYLESLALFDLYQGPPLPEGHKSLAFHLRFRHPKRTLRDEEVEEAVSRVAEALRARGFGLRGLDTP 785
               SCOP domains d1eiyb1 B:1-38,B:152-190              d1eiyb3 B:39-151 Domain B2 of PheRS-beta, PheT                                                                   d1eiyb1 B:1-38,B:152-190               d1eiyb6 B:191-399 B3/B4 domain of PheRS, PheT                                                                                                                                                                    d1eiyb2 B:400-474 Domains B1 and B5 of PheRS-beta, PheT                    d1eiyb5 B:475-681 Phenyl-tRNA synthetase (PheRS) beta subunit, PheT, central domain                                                                                                                            d1eiyb4 B:682-785 Phenylalanyl-tRNA synthetase                                                           SCOP domains
               CATH domains 1eiyB01 B:1-37,B:154-186             1eiyB02 B:38-153 Nucleic acid-binding proteins                                                                      1eiyB01 B:1-37,B:154-186         1eiyB03 B:187-400 Phenylalanyl-trna Synthetase, Chain B, domain 3                                                                                                                                                     1eiyB04 B:401-474  [code=3.30.56.20, no name defined]                     --------------1eiyB05 B:489-679 Bira Bifunctional Protein; Domain 2                                                                                                                                          ----------1eiyB06 B:690-775  [code=3.30.70.380, no name defined]                                ---------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..eehhhhhhhh....hhhhhhhhhhhhh.....eeee......eeeee..eeee......eeeeee...eeeeee........eeeeee...ee......ee.eeee..eeee....hhhhhh..........ee................eeee............hhhhhhhhhh..............ee......eeee........eeeeeee.......hhhhhhhhhh......hhhhhhhhhhhhhhh...eeee.hhhh.eeeeee.....................eeeeeee..eeeeee.................eeeee....hhhhhhhhhhhhh..hhhhhhhhhh....hhhhhhhhhhhhhhhhh..eee...eee...........hhhhhhhhhh...hhhhhhhhhhh...ee........ee.........hhhhhhhhhhhhhhhhhh.........hhhhh..hhhhhhhhhhhhhhhhhh.ee.....ee..hhhhhh.......ee....hhhhhee...hhhhhhhhhhhhhhhhh.....ee...eee...eeeeeeeeee.............hhhhhhhhhhhhhhhh....eeeee..........eeeeee..eeeeeee..hhhhhhhh....eeeeeeee....................eeee......hhhhhhhhhhhhh.......eeeeeee........eeeeee...........hhhhhhhhhhhhhhhhh........... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------TRBD  PDB: B:39-147 UniProt: 39-147                                                                          -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------B5  PDB: B:399-474 UniProt: 399-474                                         ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------FDX_ACB  PDB: B:688-780 UniProt: 688-780                                                     ----- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1eiy B   1 MRVPFSWLKAYVPELESPEVLEERLAGLGFETDRIERVFPIPRGVVFARVLEAHPIPGTRLKRLVLDAGRTVEVVSGAENARKGIGVALALPGTELPGLGQKVGERVIQGVRSFGMALSPRELGVGEYGGGLLEFPEDALPPGTPLSEAWPEEVVLDLEVTPNRPDALGLLGLARDLHALGYALVEPEAALKAEALPLPFALKVEDPEGAPHFTLGYAFGLRVAPSPLWMQRALFAAGMRPINNVVDVTNYVMLERAQPMHAFDLRFVGEGIAVRRAREGERLKTLDGVERTLHPEDLVIAGWRGEESFPLGLAGVMGGAESEVREDTEAIALEVACFDPVSIRKTARRHGLRTEASHRFERGVDPLGQVPAQRRALSLLQALAGARVAEALLEAGSPKPPEAIPFRPEYANRLLGTSYPEAEQIAILKRLGCRVEGEGPTYRVTPPSHRLDLRLEEDLVEEVARIQGYETIPLALPAFFPAPDNRGVEAPYRKEQRLREVLSGLGFQEVYTYSFMDPEDARRFRLDPPRLLLLNPLAPEKAALRTHLFPGLVRVLKENLDLDRPERALLFEVGRVFREREETHLAGLLFGEGVGLPWAKERLSGYFLLKGYLEALFARLGLAFRVEAQAFPFLHPGVSGRVLVEGEEVGFLGALHPEIAQELELPPVHLFELRLPLPDKPLAFQDPSRHPAAFRDLAVVVPAPTPYGEVEALVREAAGPYLESLALFDLYQGPPLPEGHKSLAFHLRFRHPKRTLRDEEVEEAVSRVAEALRARGFGLRGLDTP 785
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780     


Chain C from PDB  Type:RNA  Length:76
                                                                                                            
                 1eiy C   1 GCCGAGGUAGCUCAGUUGGUAGAGCAUGCGACUGAAAAUCGCAGUGUCCGCGGUUCGAUUCCGCGCCUCGGCACCA  76
                                    10        20        30        40        50        60        70
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (7, 8)

Asymmetric Unit
(-)
Class: All alpha proteins (14657)
(-)
Class: All beta proteins (24004)
(-)
Class: Alpha and beta proteins (a+b) (23004)

(-) CATH Domains  (6, 7)

Asymmetric Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1EIY)

(-) Gene Ontology  (15, 40)

Asymmetric Unit(hide GO term definitions)
Chain A   (SYFA_THETH | P27001)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0000287    magnesium ion binding    Interacting selectively and non-covalently with magnesium (Mg) ions.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0004826    phenylalanine-tRNA ligase activity    Catalysis of the reaction: ATP + L-phenylalanine + tRNA(Phe) = AMP + diphosphate + L-phenylalanyl-tRNA(Phe).
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
biological process
    GO:0006432    phenylalanyl-tRNA aminoacylation    The process of coupling phenylalanine to phenylalanyl-tRNA, catalyzed by phenylalanyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Chain A   (SYFA_THET8 | Q5SGX2)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0000287    magnesium ion binding    Interacting selectively and non-covalently with magnesium (Mg) ions.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0004826    phenylalanine-tRNA ligase activity    Catalysis of the reaction: ATP + L-phenylalanine + tRNA(Phe) = AMP + diphosphate + L-phenylalanyl-tRNA(Phe).
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
biological process
    GO:0006432    phenylalanyl-tRNA aminoacylation    The process of coupling phenylalanine to phenylalanyl-tRNA, catalyzed by phenylalanyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0006418    tRNA aminoacylation for protein translation    The synthesis of aminoacyl tRNA by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, to be used in ribosome-mediated polypeptide synthesis.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

Chain B   (SYFB_THET8 | Q5SGX1)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0004812    aminoacyl-tRNA ligase activity    Catalysis of the formation of aminoacyl-tRNA from ATP, amino acid, and tRNA with the release of diphosphate and AMP.
    GO:0016874    ligase activity    Catalysis of the joining of two substances, or two groups within a single molecule, with the concomitant hydrolysis of the diphosphate bond in ATP or a similar triphosphate.
    GO:0000287    magnesium ion binding    Interacting selectively and non-covalently with magnesium (Mg) ions.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0004826    phenylalanine-tRNA ligase activity    Catalysis of the reaction: ATP + L-phenylalanine + tRNA(Phe) = AMP + diphosphate + L-phenylalanyl-tRNA(Phe).
    GO:0000049    tRNA binding    Interacting selectively and non-covalently with transfer RNA.
biological process
    GO:0006432    phenylalanyl-tRNA aminoacylation    The process of coupling phenylalanine to phenylalanyl-tRNA, catalyzed by phenylalanyl-tRNA synthetase. In tRNA aminoacylation, the amino acid is first activated by linkage to AMP and then transferred to either the 2'- or the 3'-hydroxyl group of the 3'-adenosine residue of the tRNA.
    GO:0043039    tRNA aminoacylation    The chemical reactions and pathways by which the various amino acids become bonded to their corresponding tRNAs. The most common route for synthesis of aminoacyl tRNA is by the formation of an ester bond between the 3'-hydroxyl group of the most 3' adenosine of the tRNA, usually catalyzed by the cognate aminoacyl-tRNA ligase. A given aminoacyl-tRNA ligase aminoacylates all species of an isoaccepting group of tRNA molecules.
    GO:0008033    tRNA processing    The process in which a pre-tRNA molecule is converted to a mature tRNA, ready for addition of an aminoacyl group.
    GO:0006412    translation    The cellular metabolic process in which a protein is formed, using the sequence of a mature mRNA or circRNA molecule to specify the sequence of amino acids in a polypeptide chain. Translation is mediated by the ribosome, and begins with the formation of a ternary complex between aminoacylated initiator methionine tRNA, GTP, and initiation factor 2, which subsequently associates with the small subunit of the ribosome and an mRNA or circRNA. Translation ends with the release of a polypeptide chain from the ribosome.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1eiy)
 
  Sites
(no "Sites" information available for 1eiy)
 
  Cis Peptide Bonds
    Glu A:262 - Pro A:263   [ RasMol ]  
    Gly B:439 - Pro B:440   [ RasMol ]  
    Leu B:675 - Pro B:676   [ RasMol ]  
    Pro A:192 - Pro A:193   [ RasMol ]  
    Pro B:734 - Pro B:735   [ RasMol ]  
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym. Unit PNG format | Biol. Unit 1 PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1eiy
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  SYFA_THET8 | Q5SGX2
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
  SYFA_THETH | P27001
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
  SYFB_THET8 | Q5SGX1
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  6.1.1.20
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  SYFA_THET8 | Q5SGX2
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  SYFA_THETH | P27001
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
  SYFB_THET8 | Q5SGX1
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        SYFA_THET8 | Q5SGX2: 1jjc 1pys 3hfz
        SYFA_THETH | P27001: 1b70 1b7y 2akw 2aly 2amc 2iy5 3hfz 3teh 4tva
        SYFB_THET8 | Q5SGX1: 1jjc 1pys 3hfz

(-) Related Entries Specified in the PDB File

1pys PHENYLALANYL-TRNA SYNTHETASE FROM THERMUS THERMOPHILUS