Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  STRUCTURE AND FUNCTION OF THE B/HLH/Z DOMAIN OF USF
 
Authors :  A. R. Ferre-D'Amare, P. Pognonec, R. G. Roeder, S. K. Burley
Date :  15 Mar 97  (Deposition) - 17 Sep 97  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.90
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Protein-Dna Complex, Double Helix, Overhanging Base, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  A. R. Ferre-D'Amare, P. Pognonec, R. G. Roeder, S. K. Burley
Structure And Function Of The B/Hlh/Z Domain Of Usf.
Embo J. V. 13 180 1994
PubMed-ID: 8306960
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA (5'- D(*CP*AP*CP*CP*CP*GP*GP*TP*CP*AP*CP*GP*TP*GP*GP*CP*C P*TP*AP*CP*A)-3')
    Chains: C
    Engineered: YES
 
Molecule 2 - DNA (5'- D(*GP*TP*GP*TP*AP*GP*GP*CP*CP*AP*CP*GP*TP*GP*AP*CP*C P*GP*GP*GP*T)-3')
    Chains: D
    Engineered: YES
    Synonym: UPSTREAM STIMULATORY FACTOR 1
 
Molecule 3 - PROTEIN (UPSTREAM STIMULATORY FACTOR)
    Chains: A, B
    Engineered: YES
    Expression System: BACTERIA
    Expression System Common: EUBACTERIA
    Expression System Taxid: 2
    Mutation: YES
    Organism Common: HUMAN
    Organism Scientific: HOMO SAPIENS
    Organism Taxid: 9606

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1AN4)

(-) Sites  (0, 0)

(no "Site" information available for 1AN4)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1AN4)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1AN4)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1AN4)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1BHLHPS50888 Myc-type, basic helix-loop-helix (bHLH) domain profile.USF1_HUMAN199-254
 		  2A:199-254
B:199-254

(-) Exons   (3, 6)

Asymmetric/Biological Unit (3, 6)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1aENST000003680211aENSE00001428030chr1:161015767-161015648120USF1_HUMAN-00--
1.3aENST000003680213aENSE00002147024chr1:161013150-16101305893USF1_HUMAN1-330--
1.4ENST000003680214ENSE00001746678chr1:161012672-16101262350USF1_HUMAN3-20180--
1.5bENST000003680215bENSE00001040957chr1:161012460-161012345116USF1_HUMAN20-58390--
1.6ENST000003680216ENSE00001674948chr1:161012007-161011906102USF1_HUMAN59-92340--
1.7cENST000003680217cENSE00001040951chr1:161011636-161011441196USF1_HUMAN93-158660--
1.7hENST000003680217hENSE00001040943chr1:161011201-16101111488USF1_HUMAN158-187300--
1.8ENST000003680218ENSE00001040944chr1:161010662-16101060459USF1_HUMAN187-207212A:196-207
B:196-207		12
12
1.9aENST000003680219aENSE00001040942chr1:161010460-16101036695USF1_HUMAN207-238322A:207-238
B:207-238		32
32
1.9eENST000003680219eENSE00001040940chr1:161010120-161009992129USF1_HUMAN239-281432A:239-260
B:239-260		22
22
1.10fENST0000036802110fENSE00001446148chr1:161009799-161009041759USF1_HUMAN282-310290--

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:65
 aligned with USF1_HUMAN | P22415 from UniProtKB/Swiss-Prot  Length:310

    Alignment length:65
                                   205       215       225       235       245       255     
           USF1_HUMAN   196 RDEKRRAQHNEVERRRRDKINNWIVQLSKIIPDCSMESTKSGQSKGGILSKACDYIQELRQSNHR 260
               SCOP domains d1an4a_ A: Usf B/HLH domain                                       SCOP domains
               CATH domains 1an4A00 A:196-260 MYOD Basic-Helix-Loop-Helix Domain, subunit B   CATH domains
               Pfam domains ----------------------------------------------------------------- Pfam domains
         Sec.struct. author .........hhhhhhhhhhhhhhhhhhhhh.....................hhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---BHLH  PDB: A:199-254 UniProt: 199-254                   ------ PROSITE
           Transcript 1 (1) Exon 1.8    -------------------------------Exon 1.9e [INCOMPLETE] Transcript 1 (1)
           Transcript 1 (2) -----------Exon 1.9a  PDB: A:207-238       ---------------------- Transcript 1 (2)
                 1an4 A 196 MDEKRRAQHNEVERRRRDKINNWIVQLSKIIPDSSMESTKSGQSKGGILSKASDYIQELRQSNHR 260
                                   205       215       225       235       245       255     


Chain B from PDB  Type:PROTEIN  Length:65
 aligned with USF1_HUMAN | P22415 from UniProtKB/Swiss-Prot  Length:310

    Alignment length:65
                                   205       215       225       235       245       255     
           USF1_HUMAN   196 RDEKRRAQHNEVERRRRDKINNWIVQLSKIIPDCSMESTKSGQSKGGILSKACDYIQELRQSNHR 260
               SCOP domains d1an4b_ B: Usf B/HLH domain                                       SCOP domains
               CATH domains 1an4B00 B:196-260 MYOD Basic-Helix-Loop-Helix Domain, subunit B   CATH domains
               Pfam domains ----------------------------------------------------------------- Pfam domains
         Sec.struct. author ......hhhhhhhhhhhhh..hhhhhh..................hhhhh............... Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---BHLH  PDB: B:199-254 UniProt: 199-254                   ------ PROSITE
           Transcript 1 (1) Exon 1.8    -------------------------------Exon 1.9e [INCOMPLETE] Transcript 1 (1)
           Transcript 1 (2) -----------Exon 1.9a  PDB: B:207-238       ---------------------- Transcript 1 (2)
                 1an4 B 196 MDEKRRAQHNEVERRRRDKINNWIVQLSKIIPDSSMESTKSGQSKGGILSKASDYIQELRQSNHR 260
                                   205       215       225       235       245       255     


Chain C from PDB  Type:DNA  Length:21
                                                     
                 1an4 C 301 CACCCGGTCACGTGGCCTACA 321
                                   310       320 


Chain D from PDB  Type:DNA  Length:21
                                                     
                 1an4 D 322 GTGTAGGCCACGTGACCGGGT 342
                                   331       341
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Class: All alpha proteins (14657)

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Class: Few Secondary Structures (1120)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1AN4)

(-) Gene Ontology  (33, 33)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (USF1_HUMAN | P22415)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0043425    bHLH transcription factor binding    Interacting selectively and non-covalently with any of the basic Helix-Loop-Helix (bHLH) superfamily of transcription factors, important regulatory components in transcriptional networks of many developmental pathways.
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0019899    enzyme binding    Interacting selectively and non-covalently with any enzyme.
    GO:0042826    histone deacetylase binding    Interacting selectively and non-covalently with the enzyme histone deacetylase.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046983    protein dimerization activity    The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits.
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0042803    protein homodimerization activity    Interacting selectively and non-covalently with an identical protein to form a homodimer.
    GO:0019901    protein kinase binding    Interacting selectively and non-covalently with a protein kinase, any enzyme that catalyzes the transfer of a phosphate group, usually from ATP, to a protein substrate.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003705    transcription factor activity, RNA polymerase II distal enhancer sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in a distal enhancer region for RNA polymerase II (RNAP II) in order to modulate transcription by RNAP II.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
biological process
    GO:0045990    carbon catabolite regulation of transcription    A transcription regulation process in which the presence of one carbon source leads to the modulation of the frequency, rate, or extent of transcription of specific genes involved in the metabolism of other carbon sources.
    GO:0032869    cellular response to insulin stimulus    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an insulin stimulus. Insulin is a polypeptide hormone produced by the islets of Langerhans of the pancreas in mammals, and by the homologous organs of other organisms.
    GO:0042593    glucose homeostasis    Any process involved in the maintenance of an internal steady state of glucose within an organism or cell.
    GO:0006006    glucose metabolic process    The chemical reactions and pathways involving glucose, the aldohexose gluco-hexose. D-glucose is dextrorotatory and is sometimes known as dextrose; it is an important source of energy for living organisms and is found free as well as combined in homo- and hetero-oligosaccharides and polysaccharides.
    GO:0019086    late viral transcription    The transcription of the final group of viral genes of the viral life cycle, following middle transcription, or where middle transcription doesn't occur, following early transcription. Involves the transcription of genes encoding structural proteins.
    GO:0055088    lipid homeostasis    Any process involved in the maintenance of an internal steady state of lipid within an organism or cell.
    GO:0051918    negative regulation of fibrinolysis    Any process that stops, prevents, or reduces the frequency, rate or extent of fibrinolysis, an ongoing process that solubilizes fibrin, resulting in the removal of small blood clots.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0000432    positive regulation of transcription from RNA polymerase II promoter by glucose    Any process involving glucose that activates or increases the rate of transcription from an RNA polymerase II promoter.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0006357    regulation of transcription from RNA polymerase II promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0000430    regulation of transcription from RNA polymerase II promoter by glucose    Any process involving glucose that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0009411    response to UV    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an ultraviolet radiation (UV light) stimulus. Ultraviolet radiation is electromagnetic radiation with a wavelength in the range of 10 to 380 nanometers.
    GO:0001666    response to hypoxia    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating lowered oxygen tension. Hypoxia, defined as a decline in O2 levels below normoxic levels of 20.8 - 20.95%, results in metabolic adaptation at both the cellular and organismal level.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005667    transcription factor complex    A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1an4)
 
  Sites
(no "Sites" information available for 1an4)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1an4)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1an4
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  USF1_HUMAN | P22415
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  USF1_HUMAN | P22415
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1AN4)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1AN4)