Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF C/EBPALPHA-DNA COMPLEX
 
Authors :  M. Miller, J. D. Shuman, T. Sebastian, Z. Dauter, P. F. Johnson
Date :  06 Feb 03  (Deposition) - 13 May 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Basic Leucine Zipper, Protein-Dna Complex, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  M. Miller, J. D. Shuman, T. Sebastian, Z. Dauter, P. F. Johnson
Structural Basis For Dna Recognition By The Basic Region Leucine Zipper Transcription Factor Ccaat/Enhancer Binding Protein Alpha
J. Biol. Chem. V. 278 15178 2003
PubMed-ID: 12578822  |  Reference-DOI: 10.1074/JBC.M300417200
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - 5'- D(*TP*TP*CP*CP*TP*AP*TP*TP*GP*CP*GP*CP*AP*AP*TP*CP*CP*AP*GP *TP*T)-3'
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 2 - 5'- D(*AP*AP*AP*CP*TP*GP*GP*AP*TP*TP*GP*CP*GP*CP*AP*AP*TP*AP*GP *GP*A)-3'
    ChainsD
    EngineeredYES
    SyntheticYES
 
Molecule 3 - CCAAT/ENHANCER BINDING PROTEIN ALPHA
    ChainsA, C
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPT5
    Expression System Taxid562
    Expression System Vector TypePLASMID
    FragmentBASIC REGION, LEUCINE ZIPPER DOMAIN
    GeneCEBPA
    Organism CommonNORWAY RAT
    Organism ScientificRATTUS NORVEGICUS
    Organism Taxid10116
    SynonymC/EBP ALPHA, TRANSCRIPTION FACTOR C/EBPALPHA

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1NWQ)

(-) Sites  (0, 0)

(no "Site" information available for 1NWQ)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1NWQ)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1NWQ)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1NWQ)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1BZIPPS50217 Basic-leucine zipper (bZIP) domain profile.CEBPA_RAT282-345
 
  2A:282-340
C:282-340

(-) Exons   (0, 0)

(no "Exon" information available for 1NWQ)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:60
 aligned with CEBPA_RAT | P05554 from UniProtKB/Swiss-Prot  Length:358

    Alignment length:60
                                   290       300       310       320       330       340
            CEBPA_RAT   281 NSNEYRVRRERNNIAVRKSRDKAKQRNVETQQKVLELTSDNDRLRKRVEQLSRELDTLRG 340
               SCOP domains d1nwqa_ A: C/ebp alpha                                       SCOP domains
               CATH domains 1nwqA00 A:281-340  [code=1.20.5.170, no name defined]        CATH domains
               Pfam domains ------------------------------------------------------------ Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------ SAPs(SNPs)
                    PROSITE -BZIP  PDB: A:282-340 UniProt: 282-345                       PROSITE
                 Transcript ------------------------------------------------------------ Transcript
                 1nwq A 281 NSNEYRVRRERNNIAVRKSRDKAKQRNVETQQKVLELTSDNDRLRKRVEQLSRELDTLRG 340
                                   290       300       310       320       330       340

Chain B from PDB  Type:DNA  Length:21
                                                     
                 1nwq B -10 TTCCTATTGCGCAATCCAGTT  11
                                    -1|       10 
                                    -1|          
                                      1          

Chain C from PDB  Type:PROTEIN  Length:60
 aligned with CEBPA_RAT | P05554 from UniProtKB/Swiss-Prot  Length:358

    Alignment length:60
                                   290       300       310       320       330       340
            CEBPA_RAT   281 NSNEYRVRRERNNIAVRKSRDKAKQRNVETQQKVLELTSDNDRLRKRVEQLSRELDTLRG 340
               SCOP domains d1nwqc_ C: C/ebp alpha                                       SCOP domains
               CATH domains 1nwqC00 C:281-340  [code=1.20.5.170, no name defined]        CATH domains
           Pfam domains (1) bZIP_2-1nwqC01 C:281-334                              ------ Pfam domains (1)
           Pfam domains (2) bZIP_2-1nwqC02 C:281-334                              ------ Pfam domains (2)
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------ SAPs(SNPs)
                    PROSITE -BZIP  PDB: C:282-340 UniProt: 282-345                       PROSITE
                 Transcript ------------------------------------------------------------ Transcript
                 1nwq C 281 NSNEYRVRRERNNIAVRKSRDKAKQRNVETQQKVLELTSDNDRLRKRVEQLSRELDTLRG 340
                                   290       300       310       320       330       340

Chain D from PDB  Type:DNA  Length:21
                                                     
                 1nwq D -12 AAACTGGATTGCGCAATAGGA   9
                                    -3 ||      8 
                                      -1|        
                                        1        

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Clan: bZIP (54)

(-) Gene Ontology  (47, 47)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,C   (CEBPA_RAT | P05554)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0071837    HMG box domain binding    Interacting selectively and non-covalently with an HMG box domain, a protein domain that consists of three helices in an irregular array. HMG-box domains are found in one or more copies in HMG-box proteins, which form a large, diverse family involved in the regulation of DNA-dependent processes such as transcription, replication, and strand repair, all of which require the bending and unwinding of chromatin.
    GO:0001013    RNA polymerase I regulatory region DNA binding    Interacting selectively and non-covalently with a DNA region that controls the transcription of a region of DNA by RNA polymerase I. Binding may occur as a sequence specific interaction or as an interaction observed only once a factor has been recruited to the DNA by other factors.
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0042826    histone deacetylase binding    Interacting selectively and non-covalently with the enzyme histone deacetylase.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0032403    protein complex binding    Interacting selectively and non-covalently with any protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0019904    protein domain specific binding    Interacting selectively and non-covalently with a specific domain of a protein.
    GO:0046982    protein heterodimerization activity    Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer.
    GO:0042803    protein homodimerization activity    Interacting selectively and non-covalently with an identical protein to form a homodimer.
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003713    transcription coactivator activity    Interacting selectively and non-covalently with a activating transcription factor and also with the basal transcription machinery in order to increase the frequency, rate or extent of transcription. Cofactors generally do not bind the template nucleic acid, but rather mediate protein-protein interactions between activating transcription factors and the basal transcription machinery.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0008134    transcription factor binding    Interacting selectively and non-covalently with a transcription factor, any protein required to initiate or regulate transcription.
    GO:0001077    transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to activate or increase the frequency, rate or extent of transcription from the RNAP II promoter.
biological process
    GO:0006953    acute-phase response    An acute inflammatory response that involves non-antibody proteins whose concentrations in the plasma increase in response to infection or injury of homeothermic animals.
    GO:0031100    animal organ regeneration    The regrowth of a lost or destroyed animal organ.
    GO:0030154    cell differentiation    The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state.
    GO:0035690    cellular response to drug    Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a drug stimulus. A drug is a substance used in the diagnosis, treatment or prevention of a disease.
    GO:0045444    fat cell differentiation    The process in which a relatively unspecialized cell acquires specialized features of an adipocyte, an animal connective tissue cell specialized for the synthesis and storage of fat.
    GO:0042593    glucose homeostasis    Any process involved in the maintenance of an internal steady state of glucose within an organism or cell.
    GO:0030851    granulocyte differentiation    The process in which a myeloid precursor cell acquires the specialized features of a granulocyte. Granulocytes are a class of leukocytes characterized by the presence of granules in their cytoplasm. These cells are active in allergic immune reactions such as arthritic inflammation and rashes. This class includes basophils, eosinophils and neutrophils.
    GO:0055088    lipid homeostasis    Any process involved in the maintenance of an internal steady state of lipid within an organism or cell.
    GO:0001889    liver development    The process whose specific outcome is the progression of the liver over time, from its formation to the mature structure. The liver is an exocrine gland which secretes bile and functions in metabolism of protein and carbohydrate and fat, synthesizes substances involved in the clotting of the blood, synthesizes vitamin A, detoxifies poisonous substances, stores glycogen, and breaks down worn-out erythrocytes.
    GO:0030324    lung development    The process whose specific outcome is the progression of the lung over time, from its formation to the mature structure. In all air-breathing vertebrates the lungs are developed from the ventral wall of the oesophagus as a pouch which divides into two sacs. In amphibians and many reptiles the lungs retain very nearly this primitive sac-like character, but in the higher forms the connection with the esophagus becomes elongated into the windpipe and the inner walls of the sacs become more and more divided, until, in the mammals, the air spaces become minutely divided into tubes ending in small air cells, in the walls of which the blood circulates in a fine network of capillaries. In mammals the lungs are more or less divided into lobes, and each lung occupies a separate cavity in the thorax.
    GO:0007613    memory    The activities involved in the mental information processing system that receives (registers), modifies, stores, and retrieves informational stimuli. The main stages involved in the formation and retrieval of memory are encoding (processing of received information by acquisition), storage (building a permanent record of received information as a result of consolidation) and retrieval (calling back the stored information and use it in a suitable way to execute a given task).
    GO:0007275    multicellular organism development    The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult).
    GO:0008285    negative regulation of cell proliferation    Any process that stops, prevents or reduces the rate or extent of cell proliferation.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0002076    osteoblast development    The process whose specific outcome is the progression of an osteoblast over time, from its formation to the mature structure. Osteoblast development does not include the steps involved in committing a cranial neural crest cell or an osteoprogenitor cell to an osteoblast fate. An osteoblast is a cell that gives rise to bone.
    GO:0045600    positive regulation of fat cell differentiation    Any process that activates or increases the frequency, rate or extent of adipocyte differentiation.
    GO:0045944    positive regulation of transcription from RNA polymerase II promoter    Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0071548    response to dexamethasone    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a dexamethasone stimulus.
    GO:0007584    response to nutrient    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a nutrient stimulus.
    GO:0080184    response to phenylpropanoid    Any process that results in a change in state or activity of a cell or organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as the result of a phenylpropanoid stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. A phenylpropanoid is any of secondary metabolites with structures based on a phenylpropane skeleton. The class includes phenylpropanoid esters, flavonoids, anthocyanins, coumarins and many small phenolic molecules. Phenylpropanoids are also precursors of lignin.
    GO:0033274    response to vitamin B2    Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a vitamin B2 stimulus.
    GO:0006360    transcription from RNA polymerase I promoter    The synthesis of RNA from a DNA template by RNA polymerase I (RNAP I), originating at an RNAP I promoter.
    GO:0006366    transcription from RNA polymerase II promoter    The synthesis of RNA from a DNA template by RNA polymerase II, originating at an RNA polymerase II promoter. Includes transcription of messenger RNA (mRNA) and certain small nuclear RNAs (snRNAs).
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0036488    CHOP-C/EBP complex    A heterodimeric protein complex that is composed of the transcription factor CHOP (GADD153) and a member of the C/EBP family of transcription factors.
    GO:0035189    Rb-E2F complex    A multiprotein complex containing a heterodimeric E2F transcription factor and a Retinoblastoma (Rb) family member. This complex is capable of repressing transcription of E2F-regulated genes in order to regulate cell cycle progression.
    GO:0016363    nuclear matrix    The dense fibrillar network lying on the inner side of the nuclear membrane.
    GO:0005730    nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0043234    protein complex    A stable macromolecular complex composed (only) of two or more polypeptide subunits along with any covalently attached molecules (such as lipid anchors or oligosaccharide) or non-protein prosthetic groups (such as nucleotides or metal ions). Prosthetic group in this context refers to a tightly bound cofactor. The component polypeptide subunits may be identical.
    GO:0005667    transcription factor complex    A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1nwq)
 
  Sites
(no "Sites" information available for 1nwq)
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1nwq)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1nwq
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  CEBPA_RAT | P05554
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  CEBPA_RAT | P05554
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1NWQ)

(-) Related Entries Specified in the PDB File

1dh3 CRYSTAL STRUCTURE OF A CREB BZIP-CRE COMPLEX REVEALS THE BASIS FOR CREB FAMILY SELECTIVE DIMERIZATION AND DNA BINDING