Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  HUMAN TBX3, A TRANSCRIPTION FACTOR RESPONSIBLE FOR ULNAR-MAMMARY SYNDROME , BOUND TO A PALINDROMIC DNA SITE
 
Authors :  M. Coll, C. W. Muller
Date :  13 Jun 01  (Deposition) - 19 Apr 02  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.70
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Transcription Factor, Tbx3, T-Box Transcription Factor, Ulnar-Mammary Syndrome, Holt-Oram-Syndrome, Ig-Fold, Dna-Binding, Repressor, Nuclear Protein, Developmental Protein (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  M. Coll, J. G. Seidman, C. W. Muller
Structure Of The Dna-Bound T-Box Domain Of Human Tbx3, A Transcription Factor Responsible For Ulnar- Mammary Syndrome
Structure V. 10 343 2002
PubMed-ID: 12005433  |  Reference-DOI: 10.1016/S0969-2126(02)00722-0
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - T-BOX TRANSCRIPTION FACTOR TBX3
    Chains: A, B
    Engineered: YES
    Expression System: ESCHERICHIA COLI
    Expression System Plasmid: PT7-7
    Expression System Strain: BL21
    Expression System Taxid: 511693
    Expression System Variant: DE3
    Fragment: T-DOMAIN RESIDUES 101-291
    Organism Common: HUMAN
    Organism Scientific: HOMO SAPIENS
    Organism Taxid: 9606
    Synonym: TBX3 TRANSCRIPTION FACTOR, T-BOX PROTEIN 3
 
Molecule 2 - 5'-D(*TP*AP*AP*TP*TP*TP*CP*AP*CP*AP*CP*CP*TP* AP*GP*GP*TP*GP*TP*GP*AP*AP*AP*T)-3'
    Chains: C, D
    Fragment: PALINDROMIC BINDING SITE
    Organism Scientific: SYNTHETIC
    Organism Taxid: 32630
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 1)

Asymmetric/Biological Unit (1, 1)
No.NameCountTypeFull Name
1MG1Ligand/IonMAGNESIUM ION

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREHOH A:2015 , HOH A:2016 , HOH A:2049 , HOH A:2107 , HOH A:2108 , HOH A:2109BINDING SITE FOR RESIDUE MG A1286

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1H6F)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric/Biological Unit
No.Residues
1Phe A:133 -Pro A:134
2Ser A:190 -Pro A:191
3Phe B:133 -Pro B:134
4Ser B:190 -Pro B:191

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (2, 4)

Asymmetric/Biological Unit (2, 4)
  dbSNPPDB
No.SourceVariant IDVariantUniProt IDStatusIDChainVariant
1UniProtVAR_009601L143PTBX3_HUMANDisease (UMS)  ---A/BL143P
2UniProtVAR_009602Y149STBX3_HUMANDisease (UMS)  ---A/BY149S
  SNP/SAP Summary Statistics (UniProtKB/Swiss-Prot)

(-) PROSITE Motifs  (3, 6)

Asymmetric/Biological Unit (3, 6)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1TBOX_3PS50252 T-box domain profile.TBX3_HUMAN107-305
 		  2A:107-285
B:107-285
2TBOX_1PS01283 T-box domain signature 1.TBX3_HUMAN112-131
 		  2A:112-131
B:112-131
3TBOX_2PS01264 T-box domain signature 2.TBX3_HUMAN186-204
 		  2A:186-204
B:186-204

(-) Exons   (4, 8)

Asymmetric/Biological Unit (4, 8)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1ENST000002575661ENSE00001201439chr12:115121969-1151206171353TBX3_HUMAN1-1301302A:102-130
B:100-130		29
31
1.2aENST000002575662aENSE00000755589chr12:115118951-115118684268TBX3_HUMAN130-219902A:130-219
B:130-219		90
90
1.3ENST000002575663ENSE00000918026chr12:115117777-11511771860TBX3_HUMAN220-239200--
1.4ENST000002575664ENSE00001768567chr12:115117456-115117310147TBX3_HUMAN240-288492A:220-268
B:220-268		49
49
1.5ENST000002575665ENSE00000918024chr12:115115461-11511538577TBX3_HUMAN289-314262A:269-285
B:269-285		17
17
1.6ENST000002575666ENSE00001201415chr12:115114275-115114118158TBX3_HUMAN314-367540--
1.7bENST000002575667bENSE00000918022chr12:115112640-115111970671TBX3_HUMAN367-5902240--
1.8aENST000002575668aENSE00001266014chr12:115110107-1151080592049TBX3_HUMAN591-7431530--

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:PROTEIN  Length:184
 aligned with TBX3_HUMAN | O15119 from UniProtKB/Swiss-Prot  Length:743

    Alignment length:204
                                   111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301    
           TBX3_HUMAN   102 DPKVHLEAKELWDQFHKRGTEMVITKSGRRMFPPFKVRCSGLDKKAKYILLMDIIAADDCRYKFHNSRWMVAGKADPEMPKRMYIHPDSPATGEQWMSKVVTFHKLKLTNNISDKHGFTLAFPSDHATWQGNYSFGTQTILNSMHKYQPRFHIVRANDILKLPYSTFRTYLFPETEFIAVTAYQNDKITQLKIDNNPFAKGFRD 305
               SCOP domains d1h6fa_ A: T-box protein 3, tbx3                                                                                                                                                                             SCOP domains
               CATH domains 1h6fA00 A:102-285  [code=2.60.40.820, no name defined]                                                                                                                                                       CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author ..eeee.hhhhhhhhhhhh.eee............eeeee......eeeeeeeeeeeeeeeeeee...........................hhhhh...ee.....ee.........--------------------ee....eeeeeeeeee...hhhhhhhh..eeee.hhhheeee....hhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) -----------------------------------------P-----S------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                PROSITE (1) -----TBOX_3  PDB: A:107-285 UniProt: 107-305                                                                                                                                                                 PROSITE (1)
                PROSITE (2) ----------TBOX_1              ------------------------------------------------------TBOX_2             ----------------------------------------------------------------------------------------------------- PROSITE (2)
           Transcript 1 (1) Exon 1.1  PDB: A:102-130     -----------------------------------------------------------------------------------------Exon 1.3  PDB: -    Exon 1.4  PDB: A:220-268 UniProt: 240-288        Exon 1.5          Transcript 1 (1)
           Transcript 1 (2) ----------------------------Exon 1.2a  PDB: A:130-219 UniProt: 130-219                                                -------------------------------------------------------------------------------------- Transcript 1 (2)
                 1h6f A 102 DPKVHLEAKELWDQFHKRGTEMVITKSGRRMFPPFKVRCSGLDKKAKYILLMDIIAADDCRYKFHNSRWMVAGKADPEMPKRMYIHPDSPATGEQWMSKVVTFHKLKLTNNISDKHGF--------------------TILNSMHKYQPRFHIVRANDILKLPYSTFRTYLFPETEFIAVTAYQNDKITQLKIDNNPFAKGFRD 285
                                   111       121       131       141       151       161       171       181       191       201       211       | -         -       221       231       241       251       261       271       281    
                                                                                                                                               219                  220                                                                 


Chain B from PDB  Type:PROTEIN  Length:186
 aligned with TBX3_HUMAN | O15119 from UniProtKB/Swiss-Prot  Length:743

    Alignment length:206
                                   109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299      
           TBX3_HUMAN   100 EDDPKVHLEAKELWDQFHKRGTEMVITKSGRRMFPPFKVRCSGLDKKAKYILLMDIIAADDCRYKFHNSRWMVAGKADPEMPKRMYIHPDSPATGEQWMSKVVTFHKLKLTNNISDKHGFTLAFPSDHATWQGNYSFGTQTILNSMHKYQPRFHIVRANDILKLPYSTFRTYLFPETEFIAVTAYQNDKITQLKIDNNPFAKGFRD 305
               SCOP domains d1h6fb_ B: T-box protein 3, tbx3                                                                                                                                                                               SCOP domains
               CATH domains 1h6fB00 B:100-285  [code=2.60.40.820, no name defined]                                                                                                                                                         CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....eeee.hhhhhhhhhhhh.eee............eeeee......eeeeeeeeeeeeeeeeeee...........................hhhhhh..ee.....ee.........--------------------ee....eeeeeeeeee...hhhhh.....eeee.hhhheeee....hhhhhhhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------P-----S------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                PROSITE (1) -------TBOX_3  PDB: B:107-285 UniProt: 107-305                                                                                                                                                                 PROSITE (1)
                PROSITE (2) ------------TBOX_1              ------------------------------------------------------TBOX_2             ----------------------------------------------------------------------------------------------------- PROSITE (2)
           Transcript 1 (1) Exon 1.1  PDB: B:100-130       -----------------------------------------------------------------------------------------Exon 1.3  PDB: -    Exon 1.4  PDB: B:220-268 UniProt: 240-288        Exon 1.5          Transcript 1 (1)
           Transcript 1 (2) ------------------------------Exon 1.2a  PDB: B:130-219 UniProt: 130-219                                                -------------------------------------------------------------------------------------- Transcript 1 (2)
                 1h6f B 100 KDDPKVHLEAKELWDQFHKRGTEMVITKSGRRMFPPFKVRCSGLDKKAKYILLMDIIAADDCRYKFHNSRWMVAGKADPEMPKRMYIHPDSPATGEQWMSKVVTFHKLKLTNNISDKHGF--------------------TILNSMHKYQPRFHIVRANDILKLPYSTFRTYLFPETEFIAVTAYQNDKITQLKIDNNPFAKGFRD 285
                                   109       119       129       139       149       159       169       179       189       199       209       219         -         -|      229       239       249       259       269       279      
                                                                                                                                                 219                  220                                                                 


Chain C from PDB  Type:DNA  Length:24
                                                        
                 1h6f C   1 TAATTTCACACCTAGGTGTGAAAT  24
                                    10        20    


Chain D from PDB  Type:DNA  Length:24
                                                        
                 1h6f D   1 TAATTTCACACCTAGGTGTGAAAT  24
                                    10        20
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Class: All beta proteins (24004)

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1H6F)

(-) Gene Ontology  (56, 56)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (TBX3_HUMAN | O15119)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0001102    RNA polymerase II activating transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase II transcription activating factor, a protein involved in positive regulation of transcription.
    GO:0000978    RNA polymerase II core promoter proximal region sequence-specific DNA binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II.
    GO:0001085    RNA polymerase II transcription factor binding    Interacting selectively and non-covalently with an RNA polymerase II transcription factor, any protein required to initiate or regulate transcription by RNA polymerase II.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0043565    sequence-specific DNA binding    Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding.
    GO:0003700    transcription factor activity, sequence-specific DNA binding    Interacting selectively and non-covalently with a specific DNA sequence in order to modulate transcription. The transcription factor may or may not also interact selectively with a protein or macromolecular complex.
    GO:0001078    transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding    Interacting selectively and non-covalently with a sequence of DNA that is in cis with and relatively close to a core promoter for RNA polymerase II (RNAP II) in order to stop, prevent, or reduce the frequency, rate or extent of transcription from an RNA polymerase II promoter.
biological process
    GO:0009887    animal organ morphogenesis    Morphogenesis of an animal organ. An organ is defined as a tissue or set of tissues that work together to perform a specific function or functions. Morphogenesis is the process in which anatomical structures are generated and organized. Organs are commonly observed as visibly distinct structures, but may also exist as loosely associated clusters of cells that work together to perform a specific function or functions.
    GO:0008595    anterior/posterior axis specification, embryo    The specification of the anterior/posterior axis of the embryo by the products of genes expressed maternally and genes expressed in the zygote.
    GO:0003167    atrioventricular bundle cell differentiation    The process in which a relatively unspecialized cell acquires the specialized structural and/or functional features of a cell of the atrioventricular bundle. These cells are specialized cardiomyocytes that transmit signals from the AV node to the cardiac Purkinje fibers.
    GO:0001568    blood vessel development    The process whose specific outcome is the progression of a blood vessel over time, from its formation to the mature structure. The blood vessel is the vasculature carrying blood.
    GO:0060444    branching involved in mammary gland duct morphogenesis    The process in which the branching structure of the mammary gland duct is generated and organized. The mammary gland is a large compound sebaceous gland that in female mammals is modified to secrete milk.
    GO:0055007    cardiac muscle cell differentiation    The process in which a cardiac muscle precursor cell acquires specialized features of a cardiac muscle cell. Cardiac muscle cells are striated muscle cells that are responsible for heart contraction.
    GO:0060923    cardiac muscle cell fate commitment    The commitment of cells to specific cardiac muscle cell fates and their capacity to differentiate into cardiac muscle cells. Cardiac muscle cells are striated muscle cells that are responsible for heart contraction.
    GO:0007569    cell aging    An aging process that has as participant a cell after a cell has stopped dividing. Cell aging may occur when a cell has temporarily stopped dividing through cell cycle arrest (GO:0007050) or when a cell has permanently stopped dividing, in which case it is undergoing cellular senescence (GO:0090398). May precede cell death (GO:0008219) and succeed cell maturation (GO:0048469).
    GO:0090398    cellular senescence    A cell aging process stimulated in response to cellular stress, whereby normal cells lose the ability to divide through irreversible cell cycle arrest.
    GO:0042733    embryonic digit morphogenesis    The process, occurring in the embryo, by which the anatomical structures of the digit are generated and organized. A digit is one of the terminal divisions of an appendage, such as a finger or toe.
    GO:0035115    embryonic forelimb morphogenesis    The process, occurring in the embryo, by which the anatomical structures of the forelimb are generated and organized. The forelimbs are the front limbs of an animal, e.g. the arms of a human.
    GO:0035050    embryonic heart tube development    The process whose specific outcome is the progression of the embryonic heart tube over time, from its formation to the mature structure. The heart tube forms as the heart rudiment from the heart field.
    GO:0035116    embryonic hindlimb morphogenesis    The process, occurring in the embryo, by which the anatomical structures of the hindlimbs are generated and organized. The hindlimbs are the posterior limbs of an animal.
    GO:0030540    female genitalia development    The process whose specific outcome is the progression of the female genitalia over time, from formation to the mature structure.
    GO:0046884    follicle-stimulating hormone secretion    The regulated release of follicle-stimulating hormone, a gonadotropic glycoprotein hormone secreted by the anterior pituitary.
    GO:0035136    forelimb morphogenesis    The process in which the anatomical structures of the forelimb are generated and organized. The forelimbs are the front limbs of an animal, e.g. the arms of a human.
    GO:0001947    heart looping    The tube morphogenesis process in which the primitive heart tube loops asymmetrically. This looping brings the primitive heart chambers into alignment preceding their future integration. Heart looping begins with dextral-looping and ends when the main regional divisions of the mature heart and primordium of the great arterial trunks become established preceeding septation.
    GO:0003007    heart morphogenesis    The developmental process in which the heart is generated and organized. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood.
    GO:0001701    in utero embryonic development    The process whose specific outcome is the progression of the embryo in the uterus over time, from formation of the zygote in the oviduct, to birth. An example of this process is found in Mus musculus.
    GO:0035108    limb morphogenesis    The process in which the anatomical structures of a limb are generated and organized. A limb is a paired appendage of a tetrapod used for locomotion or grasping.
    GO:0021761    limbic system development    The progression of the limbic system over time from its initial formation until its mature state. The limbic system is a collection of structures in the brain involved in emotion, motivation and emotional aspects of memory.
    GO:0032275    luteinizing hormone secretion    The regulated release of luteinizing hormone, a gonadotropic glycoprotein hormone secreted by the anterior pituitary.
    GO:0030539    male genitalia development    The process whose specific outcome is the progression of the male genitalia over time, from its formation to the mature structure.
    GO:0030879    mammary gland development    The process whose specific outcome is the progression of the mammary gland over time, from its formation to the mature structure. The mammary gland is a large compound sebaceous gland that in female mammals is modified to secrete milk. Its development starts with the formation of the mammary line and ends as the mature gland cycles between nursing and weaning stages.
    GO:0060596    mammary placode formation    The developmental process in which the mammary placode forms. The mammary placode is a transient lens shaped structure that will give rise to the mammary bud proper.
    GO:0048332    mesoderm morphogenesis    The process in which the anatomical structures of the mesoderm are generated and organized.
    GO:0007275    multicellular organism development    The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult).
    GO:0043066    negative regulation of apoptotic process    Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process.
    GO:0030857    negative regulation of epithelial cell differentiation    Any process that stops, prevents, or reduces the frequency, rate or extent of epithelial cell differentiation.
    GO:0045662    negative regulation of myoblast differentiation    Any process that stops, prevents, or reduces the frequency, rate or extent of myoblast differentiation. A myoblast is a mononucleate cell type that, by fusion with other myoblasts, gives rise to the myotubes that eventually develop into skeletal muscle fibers.
    GO:0000122    negative regulation of transcription from RNA polymerase II promoter    Any process that stops, prevents, or reduces the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0045892    negative regulation of transcription, DNA-templated    Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0003151    outflow tract morphogenesis    The process in which the anatomical structures of the outflow tract are generated and organized. The outflow tract is the portion of the heart through which blood flows into the arteries.
    GO:0060021    palate development    The biological process whose specific outcome is the progression of the palate from an initial condition to its mature state. This process begins with the formation of the structure and ends with the mature structure. The palate is the partition that separates the nasal and oral cavities.
    GO:0045787    positive regulation of cell cycle    Any process that activates or increases the rate or extent of progression through the cell cycle.
    GO:0008284    positive regulation of cell proliferation    Any process that activates or increases the rate or extent of cell proliferation.
    GO:2000648    positive regulation of stem cell proliferation    Any process that activates or increases the frequency, rate or extent of stem cell proliferation.
    GO:0045893    positive regulation of transcription, DNA-templated    Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0042127    regulation of cell proliferation    Any process that modulates the frequency, rate or extent of cell proliferation.
    GO:0006357    regulation of transcription from RNA polymerase II promoter    Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0060931    sinoatrial node cell development    The process whose specific outcome is the progression of a sinoatrial (SA) node cell over time, from its formation to the mature state. SA node cells are pacemaker cells that are found in the sinoatrial node.
    GO:0001501    skeletal system development    The process whose specific outcome is the progression of the skeleton over time, from its formation to the mature structure. The skeleton is the bony framework of the body in vertebrates (endoskeleton) or the hard outer envelope of insects (exoskeleton or dermoskeleton).
    GO:0010159    specification of animal organ position    The regionalization process in which information that determines the correct position at which animal organ primordia are formed is generated and perceived resulting in correct positioning of the new animal organ.
    GO:0019827    stem cell population maintenance    The process by which an organism or tissue maintains a population of stem cells of a single type. This can be achieved by a number of mechanisms: stem cell asymmetric division maintains stem cell numbers; stem cell symmetric division increases them; maintenance of a stem cell niche maintains the conditions for commitment to the stem cell fate for some types of stem cell; stem cells may arise de novo from other cell types.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
    GO:0060412    ventricular septum morphogenesis    The developmental process in which a ventricular septum is generated and organized. A ventricular septum is an anatomical structure that separates the lower chambers (ventricles) of the heart from one another.
cellular component
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Phe A:133 - Pro A:134   [ RasMol ]  
    Phe B:133 - Pro B:134   [ RasMol ]  
    Ser A:190 - Pro A:191   [ RasMol ]  
    Ser B:190 - Pro B:191   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1h6f
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP (structure derived) | HSSP (homology derived)
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TBX3_HUMAN | O15119
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  181450
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  TBX3_HUMAN | O15119
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 1H6F)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1H6F)