SCOP Search:   
        by sunid, keyword
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(use 'Shift Left-Click' to collapse/expand all levels downwards; use 'Control Left-Click' to collapse/expand all levels upwards)
 
(-)
Class: All alpha proteins (14657)
(-)
Fold: DNA/RNA-binding 3-helical bundle (1299)
(-)
Superfamily: Homeodomain-like (373)
(-)
Family: Alr1493-like (1)
(-)
Protein domain: Hypothetical protein Ava_0674 (Alr1493 orthologue) (1)
(-)
Anabaena variabilis [TaxId: 1172] (1)
2GA1A:1-102; B:CRYSTAL STRUCTURE OF A DUF433 MEMBER PROTEIN (AVA_0674) FROM ANABAENA VARIABILIS ATCC 29413 AT 2.00 A RESOLUTION
(-)
Family: AraC type transcriptional activator (2)
(-)
Protein domain: MarA (1)
(-)
Escherichia coli [TaxId: 562] (1)
1BL0A:9-62; A:63-124MULTIPLE ANTIBIOTIC RESISTANCE PROTEIN (MARA)/DNA COMPLEX
(-)
Protein domain: Rob transcription factor, N-terminal domain (1)
(-)
Escherichia coli [TaxId: 562] (1)
1D5YA:3-56; A:57-121; B:3-56; B:57-121; C:3-56; C:57-121; D:3-56; D:57-121CRYSTAL STRUCTURE OF THE E. COLI ROB TRANSCRIPTION FACTOR IN COMPLEX WITH DNA
(-)
Family: automated matches (53)
(-)
Protein domain: automated matches (53)
(-)
African clawed frog (Xenopus laevis) [TaxId: 8355] (1)
2NOGB:828-895SANT DOMAIN STRUCTURE OF XENOPUS REMODELING FACTOR ISWI
(-)
Bacillus cereus [TaxId: 1396] (1)
2WV1A:4-76; B:4-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 169-186 SUBSTITUTED BY A LINKER CONTAINING TWO THROMBIN SITES
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3UKGA:360-445CRYSTAL STRUCTURE OF RAP1/DNA COMPLEX
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
3ZOBA:SOLUTION STRUCTURE OF CHICKEN ENGRAILED 2 HOMEODOMAIN
(-)
Escherichia coli [TaxId: 562] (5)
2VKVA:6-67TETR (BD) VARIANT L17G WITH REVERSE PHENOTYPE
2XRLA:2-67TET-REPRESSOR CLASS D T103A WITH DOXYCYCLINE
4AC0A:2-67TETR(B) IN COMPLEX WITH MINOCYCLINE AND MAGNESIUM
4B1RA:2-67TETRACYCLINE REPRESSOR CLASS D MUTANT H100A IN COMPLEX WITH ISO-7-CHLORTETRACYCLINE
4B3AA:2-67TETRACYCLINE REPRESSOR CLASS D MUTANT H100A IN COMPLEX WITH TETRACYCLINE
(-)
Fission yeast (Schizosaccharomyces pombe) [TaxId: 4896] (1)
2ELKA:SOLUTION STRUCTURE OF THE SANT DOMAIN OF FISSION YEAST SPCC24B10.08C PROTEIN
(-)
Golden hamster (Mesocricetus auratus) [TaxId: 10036] (1)
2H1KA:; B:CRYSTAL STRUCTURE OF THE PDX1 HOMEODOMAIN IN COMPLEX WITH DNA
(-)
Human (Homo sapiens) [TaxId: 9606] (19)
2DA1A:SOLUTION STRUCTURE OF THE FIRST HOMEOBOX DOMAIN OF AT-BINDING TRANSCRIPTION FACTOR 1 (ATBF1)
2DA3A:SOLUTION STRUCTURE OF THE THIRD HOMEOBOX DOMAIN OF AT-BINDING TRANSCRIPTION FACTOR 1 (ATBF1)
2DA5A:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF ZINC FINGERS AND HOMEOBOXES PROTEIN 3 (TRIPLE HOMEOBOX 1 PROTEIN)
2DJNA:THE SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN DLX-5
2DMQA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF LIM/HOMEOBOX PROTEIN LHX9
2DMTA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN BARH-LIKE 1
2DMUA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN GOOSECOID
2DN0A:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF HUMAN ZINC FINGERS AND HOMEOBOXES PROTEIN 3
2K40A:NMR STRUCTURE OF HESX-1 HOMEODOMAIN DOUBLE MUTANT R31L/E42L
2L7FP:SOLUTION STRUCTURE OF THE PITX2 HOMEODOMAIN
2L7MP:SOLUTION STRUCTURE OF THE PITX2 HOMEODOMAIN R24H MUTANT
2L7ZA:NMR STRUCTURE OF A13 HOMEDOMAIN
2LTPA:SOLUTION STRUCTURE OF THE SANT2 DOMAIN OF THE HUMAN NUCLEAR RECEPTOR COREPRESSOR 2 (NCOR2), NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET ID HR4636E
2M0CA:SOLUTION NMR STRUCTURE OF HOMEOBOX DOMAIN OF HUMAN ALX4, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM (NESG) TARGET HR4490C
2M34A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS
2ME0A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS SOLVED IN THE PRESENCE OF THE DNA SEQUENCE CGACTAATTAGTCG
2ME6A:NMR STRUCTURE OF THE HOMEODOMAIN TRANSCRIPTION FACTOR GBX1 FROM HOMO SAPIENS IN COMPLEX WITH THE DNA SEQUENCE CGACTAATTAGTCG
2YUMA:SOLUTION STRUCTURE OF THE MYB-LIKE DNA-BINDING DOMAIN OF HUMAN ZZZ3 PROTEIN
3A03A:CRYSTAL STRUCTURE OF HOX11L1 HOMEODOMAIN
(-)
Mouse (Mus musculus) [TaxId: 10090] (5)
2D9AA:SOLUTION STRUCTURE OF RSGI RUH-050, A MYB DNA-BINDING DOMAIN IN MOUSE CDNA
2DMSA:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HOMEOBOX PROTEIN OTX2
2LD5A:SOLUTION NMR-DERIVED COMPLEX STRUCTURE OF HOXA13 DNA BINDING DOMAIN BOUND TO DNA
2VI6A:; B:; C:; D:; E:; F:; G:; H:CRYSTAL STRUCTURE OF THE NANOG HOMEODOMAIN
2XSDC:343-397CRYSTAL STRUCTURE OF THE DIMERIC OCT-6 (POU3F1) POU DOMAIN BOUND TO PALINDROMIC MORE DNA
(-)
Mycobacterium tuberculosis [TaxId: 1773] (12)
3G1LA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14744
3G1MA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31381
3G1OA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14500
3O8GA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14801
3O8HA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM14950
3Q0UA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31379
3Q0VA:22-92; B:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM31369
3Q0WA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM33066
3Q3SA:22-94ETHR FROM MYCOBACTERIUM TUBERCULOSIS IN COMPLEX WITH COMPOUND BDM5683
3SDGA:26-92ETHIONAMIDE BOOSTERS PART 2: COMBINING BIOISOSTERIC REPLACEMENT AND STRUCTURE-BASED DRUG DESIGN TO SOLVE PHARMACOKINETIC ISSUES IN A SERIES OF POTENT 1,2,4-OXADIAZOLE ETHR INHIBITORS.
3SFIA:22-94ETHIONAMIDE BOOSTERS PART 2: COMBINING BIOISOSTERIC REPLACEMENT AND STRUCTURE-BASED DRUG DESIGN TO SOLVE PHARMACOKINETIC ISSUES IN A SERIES OF POTENT 1,2,4-OXADIAZOLE ETHR INHIBITORS.
4DW6A:24-93NOVEL N-PHENYL-PHENOXYACETAMIDE DERIVATIVES AS POTENTIAL ETHR INHIBITORS AND ETHIONAMIDE BOOSTERS. DISCOVERY AND OPTIMIZATION USING HIGH-THROUGHPUT SYNTHESIS.
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
2D5VA:100-155; B:100-155CRYSTAL STRUCTURE OF HNF-6ALPHA DNA-BINDING DOMAIN IN COMPLEX WITH THE TTR PROMOTER
(-)
Pasteurella multocida [TaxId: 747] (1)
2VPRA:2-67TET REPRESSOR CLASS H IN COMPLEX WITH 5A,6-ANHYDROTETRACYCLINE-MG
(-)
Trichomonas vaginalis [TaxId: 5722] (4)
2K9NA:1-49; A:50-107SOLUTION NMR STRUCTURE OF THE R2R3 DNA BINDING DOMAIN OF MYB1 PROTEIN FROM PROTOZOAN PARASITE TRICHOMONAS VAGINALIS
2KDZA:1-49; A:50-107STRUCTURE OF THE R2R3 DNA BINDING DOMAIN OF MYB1 PROTEIN FROM PROTOZOAN PARASITE TRICHOMONAS VAGINALIS IN COMPLEX WITH MRE-1/MRE-2R DNA
3OSFA:48-96; A:97-150; D:48-96; D:97-150THE STRUCTURE OF PROTOZOAN PARASITE TRICHOMONAS VAGINALIS MYB2 IN COMPLEX WITH MRE-2F-13 DNA
3OSGA:40-96; A:97-150; D:48-96; D:97-150THE STRUCTURE OF PROTOZOAN PARASITE TRICHOMONAS VAGINALIS MYB2 IN COMPLEX WITH MRE-1-12 DNA
(-)
Family: Centromere-binding (3)
(-)
Protein domain: Ars-binding protein 1, ABP1 (1)
(-)
Fission yeast (Schizosaccharomyces pombe) [TaxId: 4896] (1)
1IUFA:-2-75; A:76-141LOW RESOLUTION SOLUTION STRUCTURE OF THE TWO DNA-BINDING DOMAINS IN SCHIZOSACCHAROMYCES POMBE ABP1 PROTEIN
(-)
Protein domain: DNA-binding domain of centromere binding protein B (CENP-B) (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1BW6A:HUMAN CENTROMERE PROTEIN B (CENP-B) DNA BINDIGN DOMAIN RP1
1HLVA:1-66; A:67-131CRYSTAL STRUCTURE OF CENP-B(1-129) COMPLEXED WITH THE CENP-B BOX DNA
(-)
Family: Cgl2762-like (1)
(-)
Protein domain: Uncharacterized protein Cgl2762 (1)
(-)
Corynebacterium glutamicum [TaxId: 1718] (1)
2JN6A:1-89SOLUTION NMR STRUCTURE OF PROTEIN CGL2762 FROM CORYNEBACTERIUM GLUTAMICUM: NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET CGR3
(-)
Family: DNA-binding domain of rap1 (2)
(-)
Protein domain: automated matches (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 559292] (1)
3UKGA:446-601CRYSTAL STRUCTURE OF RAP1/DNA COMPLEX
(-)
Protein domain: DNA-binding domain of rap1 (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (1)
1IGNA:360-445; A:446-594; B:360-445; B:446-594DNA-BINDING DOMAIN OF RAP1 IN COMPLEX WITH TELOMERIC DNA SITE
(-)
Family: DNA-binding domain of telomeric protein (9)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
3SJMA:; B:CRYSTAL STRUCTURE ANALYSIS OF TRF2-DBD-DNA COMPLEX
(-)
Protein domain: DNA-binding domain of human telomeric protein, hTRF1 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1BA5A:DNA-BINDING DOMAIN OF HUMAN TELOMERIC PROTEIN, HTRF1, NMR, 18 STRUCTURES
1ITYA:SOLUTION STRUCTURE OF THE DNA BINDING DOMAIN OF HUMAN TRF1
1IV6A:SOLUTION STRUCTURE OF THE DNA COMPLEX OF HUMAN TRF1
1W0TA:; B:HTRF1 DNA-BINDING DOMAIN IN COMPLEX WITH TELOMERIC DNA.
(-)
Protein domain: Telomeric repeat binding factor 2, TRF2 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (4)
1VF9A:SOLUTION STRUCTURE OF HUMAN TRF2
1VFCA:438-500SOLUTION STRUCTURE OF THE DNA COMPLEX OF HUMAN TRF2
1W0UA:; B:HTRF2 DNA-BINDING DOMAIN IN COMPLEX WITH TELOMERIC DNA.
1XG1A:5-67SOLUTION STRUCTURE OF MYB-DOMAIN OF HUMAN TRF2
(-)
Family: FIS-like (34)
(-)
Protein domain: DNA-binding domain of NTRC (1)
(-)
Salmonella typhimurium [TaxId: 90371] (1)
1NTCA:; B:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF NTRC WITH THREE ALANINE SUBSTITUTIONS
(-)
Protein domain: FIS protein (31)
(-)
Escherichia coli K-12 [TaxId: 83333] (15)
3IV5A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F1
3JR9A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F2
3JRAA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP NON CONSENSUS SEQUENCE DNA F6
3JRBA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F24 CONTAINING T-TRACT AT CENTER
3JRCA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F29 CONTAINING 5 G/CS AT CENTER
3JRDA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F25 CONTAINING T2A3 SEQUENCE AT CENTER
3JREA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F26 CONTAINING A-TRACT AT CENTER
3JRFA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F27 CONTAINING A C/G AT CENTER
3JRGA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F18
3JRHA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F21
3JRIA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F23
4IHVB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
4IHWB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
4IHXB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
4IHYB:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)
(-)
Escherichia coli [TaxId: 562] (16)
1ETKA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q68A
1ETOA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71L
1ETQA:; B:; C:; D:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT R71Y
1ETVA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72A
1ETWA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT G72D
1ETXA:; B:THE CRYSTAL STRUCTURE OF E. COLI FIS MUTANT Q74A
1ETYA:; B:THE CRYSTAL STRUCTURE OF E. COLI WILD-TYPE FIS
1F36A:; B:THE CRYSTAL STRUCTURE OF FIS MUTANT K36E REVEALS THAT THE TRANSACTIVATION REGION OF THE FIS PROTEIN CONTAINS EXTENDED MOBILE BETA-HAIRPIN ARMS
1FIAA:; B:CRYSTAL STRUCTURE OF THE FACTOR FOR INVERSION STIMULATION FIS AT 2.0 ANGSTROMS RESOLUTION
1FIPA:; B:THE STRUCTURE OF FIS MUTANT PRO61ALA ILLUSTRATES THAT THE KINK WITHIN THE LONG ALPHA-HELIX IS NOT DUE TO THE PRESENCE OF THE PROLINE RESIDUE
3FISA:; B:THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING
4FISA:; B:THE MOLECULAR STRUCTURE OF WILD-TYPE AND A MUTANT FIS PROTEIN: RELATIONSHIP BETWEEN MUTATIONAL CHANGES AND RECOMBINATIONAL ENHANCER FUNCTION OR DNA BINDING
4IHVA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
4IHWA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
4IHXA:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
4IHYA:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)
(-)
Protein domain: Photosynthetic apparatus regulatory protein PprA (RegA), DNA-binding domain (1)
(-)
Rhodobacter sphaeroides [TaxId: 1063] (1)
1UMQA:SOLUTION STRUCTURE AND DNA BINDING OF THE EFFECTOR DOMAIN FROM THE GLOBAL REGULATOR PRRA(REGA) FROM R. SPHAEROIDES: INSIGHTS INTO DNA BINDING SPECIFICITY
(-)
Protein domain: Transcriptional regulator TyrR, C-terminal domain (1)
(-)
Haemophilus influenzae [TaxId: 727] (1)
1G2HA:SOLUTION STRUCTURE OF THE DNA-BINDING DOMAIN OF THE TYRR PROTEIN OF HAEMOPHILUS INFLUENZAE
(-)
Family: GARP response regulators (1)
(-)
Protein domain: Arr10-B (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1IRZA:SOLUTION STRUCTURE OF ARR10-B BELONGING TO THE GARP FAMILY OF PLANT MYB-RELATED DNA BINDING MOTIFS OF THE ARABIDOPSIS RESPONSE REGULATORS
(-)
Family: Homeodomain (93)
(-)
Protein domain: Antennapedia Homeodomain (5)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (5)
1AHDP:DETERMINATION OF THE NMR SOLUTION STRUCTURE OF AN ANTENNAPEDIA HOMEODOMAIN-DNA COMPLEX
1HOMA:DETERMINATION OF THE THREE-DIMENSIONAL STRUCTURE OF THE ANTENNAPEDIA HOMEODOMAIN FROM DROSOPHILA IN SOLUTION BY 1H NUCLEAR MAGNETIC RESONANCE SPECTROSCOPY
1SANA:THE DES(1-6)ANTENNAPEDIA HOMEODOMAIN: COMPARISON OF THE NMR SOLUTION STRUCTURE AND THE DNA BINDING AFFINITY WITH THE INTACT ANTENNAPEDIA HOMEODOMAIN
2HOAA:STRUCTURE DETERMINATION OF THE ANTP(C39->S) HOMEODOMAIN FROM NUCLEAR MAGNETIC RESONANCE DATA IN SOLUTION USING A NOVEL STRATEGY FOR THE STRUCTURE CALCULATION WITH THE PROGRAMS DIANA, CALIBA, HABAS AND GLOMSA
9ANTA:; B:ANTENNAPEDIA HOMEODOMAIN-DNA COMPLEX
(-)
Protein domain: automated matches (13)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (5)
2R5YA:; B:STRUCTURE OF SCR/EXD COMPLEX BOUND TO A CONSENSUS HOX-EXD SITE
2R5ZA:; B:STRUCTURE OF SCR/EXD COMPLEX BOUND TO A DNA SEQUENCE DERIVED FROM THE FKH GENE
3A01A:; B:; E:; F:CRYSTAL STRUCTURE OF ARISTALESS AND CLAWLESS HOMEODOMAINS BOUND TO DNA
3A02A:CRYSTAL STRUCTURE OF ARISTALESS HOMEODOMAIN
3LNQA:STRUCTURE OF ARISTALESS HOMEODOMAIN IN COMPLEX WITH DNA
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
2DA6A:SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HEPATOCYTE NUCLEAR FACTOR 1-BETA (HNF-1BETA)
2LMDA:MINIMAL CONSTRAINTS SOLUTION NMR STRUCTURE OF PROSPERO HOMEOBOX PROTEIN 1 FROM HOMO SAPIENS, NORTHEAST STRUCTURAL GENOMICS CONSORTIUM TARGET HR4660B
2LP0A:THE SOLUTION STRUCTURE OF HOMEODOMAIN-PROTEIN COMPLEX
3CMYA:STRUCTURE OF A HOMEODOMAIN IN COMPLEX WITH DNA
3K2AA:; B:CRYSTAL STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN MEIS2
3RKQA:; B:NKX2.5 HOMEODOMAIN DIMER BOUND TO ANF-242 DNA
4J19A:; B:STRUCTURE OF A NOVEL TELOMERE REPEAT BINDING PROTEIN BOUND TO DNA
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2HI3A:SOLUTION STRUCTURE OF THE HOMEODOMAIN-ONLY PROTEIN HOP
(-)
Protein domain: DNA-binding protein SATB2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1WI3A:SOLUTION STRUCTURE OF THE HOMEODOMAIN OF KIAA1034 PROTEIN
(-)
Protein domain: Engrailed Homeodomain (12)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (12)
1DU0A:; B:ENGRAILED HOMEODOMAIN Q50A VARIANT DNA COMPLEX
1ENHA:STRUCTURAL STUDIES OF THE ENGRAILED HOMEODOMAIN
1HDDC:; D:CRYSTAL STRUCTURE OF AN ENGRAILED HOMEODOMAIN-DNA COMPLEX AT 2.8 ANGSTROMS RESOLUTION: A FRAMEWORK FOR UNDERSTANDING HOMEODOMAIN-DNA INTERACTIONS
1P7IA:; B:; C:; D:CRYSTAL STRUCTURE OF ENGRAILED HOMEODOMAIN MUTANT K52A
1P7JA:; C:; D:; B:CRYSTAL STRUCTURE OF ENGRAILED HOMEODOMAIN MUTANT K52E
1ZTRA:0-59SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN L16A MUTANT
2HDDA:; B:ENGRAILED HOMEODOMAIN Q50K VARIANT DNA COMPLEX
2HOSA:; B:PHAGE-SELECTED HOMEODOMAIN BOUND TO UNMODIFIED DNA
2HOTA:; B:PHAGE SELECTED HOMEODOMAIN BOUND TO MODIFIED DNA
2JWTA:SOLUTION STRUCTURE OF ENGRAILED HOMEODOMAIN WT
2P81A:ENGRAILED HOMEODOMAIN HELIX-TURN-HELIX MOTIF
3HDDA:; B:ENGRAILED HOMEODOMAIN DNA COMPLEX
(-)
Protein domain: Even-skipped homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1JGGA:; B:EVEN-SKIPPED HOMEODOMAIN COMPLEXED TO AT-RICH DNA
(-)
Protein domain: Extradenticle (exd) homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1B8IB:STRUCTURE OF THE HOMEOTIC UBX/EXD/DNA TERNARY COMPLEX
(-)
Protein domain: Fushi Tarazu protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1FTZA:NUCLEAR MAGNETIC RESONANCE SOLUTION STRUCTURE OF THE FUSHI TARAZU HOMEODOMAIN FROM DROSOPHILA AND COMPARISON WITH THE ANTENNAPEDIA HOMEODOMAIN
(-)
Protein domain: Hepatocyte nuclear factor 1a (LFB1/HNF1) (3)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1IC8A:201-276; B:201-278HEPATOCYTE NUCLEAR FACTOR 1A BOUND TO DNA : MODY3 GENE PRODUCT
(-)
Rat (Rattus rattus) [TaxId: 10117] (2)
1LFBA:THE X-RAY STRUCTURE OF AN ATYPICAL HOMEODOMAIN PRESENT IN THE RAT LIVER TRANSCRIPTION FACTOR LFB1(SLASH)HNF1 AND IMPLICATIONS FOR DNA BINDING
2LFBA:HOMEODOMAIN FROM RAT LIVER LFB1/HNF1 TRANSCRIPTION FACTOR, NMR, 20 STRUCTURES
(-)
Protein domain: Hepatocyte nuclear factor 6 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1S7EA:103-152SOLUTION STRUCTURE OF HNF-6
(-)
Protein domain: Homeo-prospero domain of Prospero protein (2)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (2)
1MIJA:CRYSTAL STRUCTURE OF THE HOMEO-PROSPERO DOMAIN OF D. MELANOGASTER PROSPERO
1XPXA:STRUCTURAL BASIS OF PROSPERO-DNA INTERACTION; IMPLICATIONS FOR TRANSCRIPTION REGULATION IN DEVELOPING CELLS
(-)
Protein domain: Homeobox protein hox-a9 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1PUFA:CRYSTAL STRUCTURE OF HOXA9 AND PBX1 HOMEODOMAINS BOUND TO DNA
(-)
Protein domain: Homeobox protein hox-b1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1B72A:PBX1, HOMEOBOX PROTEIN HOX-B1/DNA TERNARY COMPLEX
(-)
Protein domain: Homeobox protein hox-b13 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CRAA:7-64SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEO BOX B13
(-)
Protein domain: Homeobox protein pknox1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1X2NA:6-67SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF HUMAN HOMEOBOX PROTEIN PKNOX1
(-)
Protein domain: Homeobox protein prh (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2E1OA:8-64SOLUTION STRUCTURE OF RSGI RUH-028, A HOMEOBOX DOMAIN FROM HUMAN CDNA
(-)
Protein domain: Homeobox-containing protein 1, HMBOX1 (Flj21616) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CUFA:8-89SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF THE HUMAN HYPOTHETICAL PROTEIN FLJ21616
(-)
Protein domain: Homeobox-leucine zipper protein Homez (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2ECCA:SOLUTION STRUCTURE OF THE SECOND HOMEOBOX DOMAIN OF HUMAN HOMEODOMAIN LEUCINE ZIPPER-ENCODING GENE (HOMEZ)
(-)
Protein domain: Homeodomain-only protein, Hop (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1UHSA:SOLUTION STRUCTURE OF MOUSE HOMEODOMAIN-ONLY PROTEIN HOP
(-)
Protein domain: Homeotic bicoid protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1ZQ3P:2-68NMR SOLUTION STRUCTURE OF THE BICOID HOMEODOMAIN BOUND TO THE CONSENSUS DNA BINDING SITE TAATCC
(-)
Protein domain: Hypothetical protein 4930532d21rik (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1X58A:8-56SOLUTION STRUCTURES OF THE MYB-LIKE DNA BINDING DOMAIN OF 4930532D21RIK PROTEIN
(-)
Protein domain: Insulin gene enhancer protein isl-1 (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1BW5A:THE NMR SOLUTION STRUCTURE OF THE HOMEODOMAIN OF THE RAT INSULIN GENE ENHANCER PROTEIN ISL-1, 50 STRUCTURES
(-)
Protein domain: LAG1 longevity assurance homolog 5, LASS5 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2CQXA:8-66SOLUTION STRUCTURE OF RSGI RUH-034, A HOMEODOMAIN FROM MOUSE CDNA
(-)
Protein domain: Lag1 longevity assurance homolog 6, LASS6 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1X2MA:8-59SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF MOUSE LAG1 LONGEVITY ASSURANCE HOMOLOG 6
(-)
Protein domain: mat alpha2 Homeodomain (6)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (6)
1AKHB:MAT A1/ALPHA2/DNA TERNARY COMPLEX
1APLC:; D:CRYSTAL STRUCTURE OF A MAT-ALPHA2 HOMEODOMAIN-OPERATOR COMPLEX SUGGESTS A GENERAL MODEL FOR HOMEODOMAIN-DNA INTERACTIONS
1K61A:; B:; C:; D:MATALPHA2 HOMEODOMAIN BOUND TO DNA
1LE8B:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2-3A HETERODIMER BOUND TO DNA COMPLEX
1MNMC:; D:YEAST MATALPHA2/MCM1/DNA TERNARY TRANSCRIPTION COMPLEX CRYSTAL STRUCTURE
1YRNB:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2 HOMEODOMAIN HETERODIMER BOUND TO DNA
(-)
Protein domain: Mating type protein A1 Homeodomain (6)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (6)
1AKHA:MAT A1/ALPHA2/DNA TERNARY COMPLEX
1F43A:SOLUTION STRUCTURE OF THE MATA1 HOMEODOMAIN
1LE8A:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2-3A HETERODIMER BOUND TO DNA COMPLEX
1MH3A:472-526MALTOSE BINDING-A1 HOMEODOMAIN PROTEIN CHIMERA, CRYSTAL FORM I
1MH4A:472-523MALTOSE BINDING-A1 HOMEODOMAIN PROTEIN CHIMERA, CRYSTAL FORM II
1YRNA:CRYSTAL STRUCTURE OF THE MATA1/MATALPHA2 HOMEODOMAIN HETERODIMER BOUND TO DNA
(-)
Protein domain: Msx-1 homeodomain (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1IG7A:MSX-1 HOMEODOMAIN/DNA COMPLEX STRUCTURE
(-)
Protein domain: Oct-1 POU Homeodomain (7)
(-)
Human (Homo sapiens) [TaxId: 9606] (7)
1CQTA:102-161; B:602-661CRYSTAL STRUCTURE OF A TERNARY COMPLEX CONTAINING AN OCA-B PEPTIDE, THE OCT-1 POU DOMAIN, AND AN OCTAMER ELEMENT
1E3OC:104-160CRYSTAL STRUCTURE OF OCT-1 POU DIMER BOUND TO MORE
1GT0C:97-159CRYSTAL STRUCTURE OF A POU/HMG/DNA TERNARY COMPLEX
1HF0A:102-159; B:102-159CRYSTAL STRUCTURE OF THE DNA-BINDING DOMAIN OF OCT-1 BOUND TO DNA AS A DIMER
1O4XA:110-163TERNARY COMPLEX OF THE DNA BINDING DOMAINS OF THE OCT1 AND SOX2 TRANSCRIPTION FACTORS WITH A 19MER OLIGONUCLEOTIDE FROM THE HOXB1 REGULATORY ELEMENT
1OCTC:102-161CRYSTAL STRUCTURE OF THE OCT-1 POU DOMAIN BOUND TO AN OCTAMER SITE: DNA RECOGNITION WITH TETHERED DNA-BINDING MODULES
1POGA:SOLUTION STRUCTURE OF THE OCT-1 POU-HOMEO DOMAIN DETERMINED BY NMR AND RESTRAINED MOLECULAR DYNAMICS
(-)
Protein domain: Oct-2 POU Homeodomain (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1HDPA:SOLUTION STRUCTURE OF A POU-SPECIFIC HOMEODOMAIN: 3D-NMR STUDIES OF HUMAN B-CELL TRANSCRIPTION FACTOR OCT-2
(-)
Protein domain: Oct-3 POU Homeodomain (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1OCPA:SOLUTION STRUCTURE OF OCT3 POU-HOMEODOMAIN
(-)
Protein domain: Paired box protein pax6 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CUEA:7-74SOLUTION STRUCTURE OF THE HOMEOBOX DOMAIN OF THE HUMAN PAIRED BOX PROTEIN PAX-6
(-)
Protein domain: Paired protein (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1FJLA:; B:; C:HOMEODOMAIN FROM THE DROSOPHILA PAIRED PROTEIN BOUND TO A DNA OLIGONUCLEOTIDE
(-)
Protein domain: pbx1 (4)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1B72B:PBX1, HOMEOBOX PROTEIN HOX-B1/DNA TERNARY COMPLEX
1PUFB:CRYSTAL STRUCTURE OF HOXA9 AND PBX1 HOMEODOMAINS BOUND TO DNA
(-)
Mouse (Mus musculus) [TaxId: 10090] (2)
1DU6A:SOLUTION STRUCTURE OF THE TRUNCATED PBX HOMEODOMAIN
1LFUP:NMR SOLUTION STRUCTURE OF THE EXTENDED PBX HOMEODOMAIN BOUND TO DNA
(-)
Protein domain: Pit-1 POU homeodomain (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1AU7A:103-160; B:103-160PIT-1 MUTANT/DNA COMPLEX
(-)
Protein domain: Pituitary homeobox 2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2LKXA:1-60NMR STRUCTURE OF THE HOMEODOMAIN OF PITX2 IN COMPLEX WITH A TAATCC DNA BINDING SITE
(-)
Protein domain: Thyroid transcription factor 1 homeodomain (1)
(-)
Norway rat (Rattus norvegicus) [TaxId: 10116] (1)
1FTTA:THYROID TRANSCRIPTION FACTOR 1 HOMEODOMAIN (RATTUS NORVEGICUS)
(-)
Protein domain: Transcriptional adaptor 2-like, TADA2L, isoform b (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1X41A:8-54SOLUTION STRUCTURE OF THE MYB-LIKE DNA BINDING DOMAIN OF HUMAN TRANSCRIPTIONAL ADAPTOR 2-LIKE, ISOFORM B
(-)
Protein domain: Ultrabithorax (ubx) homeodomain (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1B8IA:STRUCTURE OF THE HOMEOTIC UBX/EXD/DNA TERNARY COMPLEX
(-)
Protein domain: VND/NK-2 protein (4)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (4)
1NK2P:VND/NK-2 HOMEODOMAIN/DNA COMPLEX, NMR, 20 STRUCTURES
1NK3P:VND/NK-2 HOMEODOMAIN/DNA COMPLEX, NMR, MINIMIZED AVERAGE STRUCTURE
1QRYA:HOMEOBOX PROTEIN VND (VENTRAL NERVOUS SYSTEM DEFECTIVE PROTEIN)
1VNDA:VND/NK-2 PROTEIN (HOMEODOMAIN), NMR
(-)
Protein domain: ZF-HD homeobox protein At4g24660 (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1WH7A:SOLUTION STRUCTURE OF HOMEOBOX DOMAIN OF ARABIDOPSIS THALIANA HYPOTHETICAL PROTEIN F22K18.140
(-)
Protein domain: ZF-HD homeobox protein At5g65410 (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
1WH5A:SOLUTION STRUCTURE OF HOMEOBOX DOMAIN OF ARABIDOPSISTHALIANA ZINC FINGER HOMEOBOX FAMILY PROTEIN
(-)
Protein domain: Zinc fingers and homeoboxes protein 1, ZHX1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2ECBA:8-83THE SOLUTION STRUCTURE OF THE THIRD HOMEOBOX DOMAIN OF HUMAN ZINC FINGERS AND HOMEOBOXES PROTEIN
(-)
Family: Middle operon regulator, Mor (1)
(-)
Protein domain: Middle operon regulator, Mor (1)
(-)
Bacteriophage Mu [TaxId: 10677] (1)
1RR7A:CRYSTAL STRUCTURE OF THE MIDDLE OPERON REGULATOR PROTEIN OF BACTERIOPHAGE MU
(-)
Family: Myb/SANT domain (34)
(-)
Protein domain: 2610100b20rik gene product (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
1UG2A:SOLUTION STRUCTURE OF MOUSE HYPOTHETICAL GENE (2610100B20RIK) PRODUCT HOMOLOGOUS TO MYB DNA-BINDING DOMAIN
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
4A69C:; D:STRUCTURE OF HDAC3 BOUND TO COREPRESSOR AND INOSITOL TETRAPHOSPHATE
(-)
Protein domain: b-Myb DNA binding domain (1)
(-)
Chicken (Gallus gallus) [TaxId: 9031] (1)
1A5JA:1-55; A:56-110CHICKEN B-MYB DNA BINDING DOMAIN, REPEAT 2 AND REPEAT3, NMR, 32 STRUCTURES
(-)
Protein domain: c-Myb, DNA-binding domain (16)
(-)
Mouse (Mus musculus) [TaxId: 10090] (16)
1GUUA:CRYSTAL STRUCTURE OF C-MYB R1
1GV2A:89-143; A:144-190CRYSTAL STRUCTURE OF C-MYB R2R3
1GV5A:CRYSTAL STRUCTURE OF C-MYB R2
1GVDA:CRYSTAL STRUCTURE OF C-MYB R2 V103L MUTANT
1H88C:39-88; C:89-143; C:144-190CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX1
1H89C:77-88; C:89-143; C:144-191CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX2
1IDYA:STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, MINIMIZED AVERAGE STRUCTURE
1IDZA:STRUCTURE OF MYB TRANSFORMING PROTEIN, NMR, 20 STRUCTURES
1MBEA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1
1MBFA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 1
1MBGA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 2
1MBHA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 2
1MBJA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 3
1MBKA:MOUSE C-MYB DNA-BINDING DOMAIN REPEAT 3
1MSEC:89-143; C:144-193SOLUTION STRUCTURE OF A SPECIFIC DNA COMPLEX OF THE MYB DNA-BINDING DOMAIN WITH COOPERATIVE RECOGNITION HELICES
1MSFC:89-143; C:144-193SOLUTION STRUCTURE OF A SPECIFIC DNA COMPLEX OF THE MYB DNA-BINDING DOMAIN WITH COOPERATIVE RECOGNITION HELICES
(-)
Protein domain: DnaJ homolog subfamily C member 1 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
2CQQA:8-66SOLUTION STRUCTURE OF RSGI RUH-037, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
2CQRA:7-66SOLUTION STRUCTURE OF RSGI RUH-043, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
(-)
Protein domain: Hypothetical protein C14orf106 (KIAA1903) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1WGXA:SOLUTION STRUCTURE OF RSGI RUH-022, A MYB DNA-BINDING DOMAIN IN HUMAN CDNA
(-)
Protein domain: Metastasis associated protein MTA3 (1)
(-)
Mouse (Mus musculus) [TaxId: 10090] (1)
2CRGA:8-64SOLUTION STRUCTURE OF THE MYB-LIKE DNA-BINDING DOMAIN OF MOUSE MTA3 PROTEIN
(-)
Protein domain: MYSM1 (KIAA1915) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2CU7A:8-72SOLUTION STRUCTURE OF THE SANT DOMAIN OF HUMAN KIAA1915 PROTEIN
(-)
Protein domain: Nuclear receptor corepressor 2 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1XC5A:413-480SOLUTION STRUCTURE OF THE SMRT DEACETYLASE ACTIVATION DOMAIN
(-)
Protein domain: Radialis (1)
(-)
Garden snapdragon (Antirrhinum majus) [TaxId: 4151] (1)
2CJJA:8-70CRYSTAL STRUCTURE OF THE MYB DOMAIN OF THE RAD TRANSCRIPTION FACTOR FROM ANTIRRHINUM MAJUS
(-)
Protein domain: Rap1 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
1FEXA:SOLUTION STRUCTURE OF MYB-DOMAIN OF HUMAN RAP1
(-)
Protein domain: REST corepressor 1, CoREST (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
2IW5B:376-440STRUCTURAL BASIS FOR COREST-DEPENDENT DEMETHYLATION OF NUCLEOSOMES BY THE HUMAN LSD1 HISTONE DEMETHYLASE
2UXNB:376-440STRUCTURAL BASIS OF HISTONE DEMETHYLATION BY LSD1 REVEALED BY SUICIDE INACTIVATION
(-)
Protein domain: SANT domain of the nucleosome remodeling ATPase ISWI (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1OFCX:799-850NUCLEOSOME RECOGNITION MODULE OF ISWI ATPASE
(-)
Protein domain: Telomere binding protein TBP1 (2)
(-)
Tobacco (Nicotiana tabacum) [TaxId: 4097] (2)
2CKXA:578-660CRYSTAL STRUCTURE OF NGTRF1, DOUBLE-STRANDED TELOMERIC REPEAT BINDING FACTOR FROM NICOTIANA TABACUM.
2QHBA:; B:CRYSTAL STRUCTURE OF NGTRF COMPLEXED WITH TELOMERIC DNA
(-)
Protein domain: Telomere repeat-binding protein (1)
(-)
Thale cress (Arabidopsis thaliana) [TaxId: 3702] (1)
2AJEA:9-105SOLUTION STRUCTURE OF THE ARABIDOPSIS THALIANA TELOMERIC REPEAT-BINDING PROTEIN DNA BINDING DOMAIN
(-)
Protein domain: v-Myb (1)
(-)
Avian myeloblastosis virus [TaxId: 11866] (1)
1H8AC:87-143; C:144-191CRYSTAL STRUCTURE OF TERNARY PROTEIN-DNA COMPLEX3
(-)
Family: Nanomeric phage protein-like (1)
(-)
Protein domain: Phage protein BC1890 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2AO9A:13-132; B:; C:; D:; E:; F:; G:; H:; I:STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PHAGE PROTEIN (PHBC6A51) FROM BACILLUS CEREUS ATCC 14579
(-)
Family: Paired domain (4)
(-)
Protein domain: Paired protein (prd) (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1PDNC:2-66; C:67-124CRYSTAL STRUCTURE OF A PAIRED DOMAIN-DNA COMPLEX AT 2.5 ANGSTROMS RESOLUTION REVEALS STRUCTURAL BASIS FOR PAX DEVELOPMENTAL MUTATIONS
(-)
Protein domain: Pax-5 (2)
(-)
Human (Homo sapiens) [TaxId: 9606] (2)
1K78A:19-81; A:82-142; E:19-81; E:82-142; I:84-141PAX5(1-149)+ETS-1(331-440)+DNA
1MDMA:19-81; A:82-142INHIBITED FRAGMENT OF ETS-1 AND PAIRED DOMAIN OF PAX5 BOUND TO DNA
(-)
Protein domain: Pax-6 (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
6PAXA:1-68; A:69-133CRYSTAL STRUCTURE OF THE HUMAN PAX-6 PAIRED DOMAIN-DNA COMPLEX REVEALS A GENERAL MODEL FOR PAX PROTEIN-DNA INTERACTIONS
(-)
Family: Psq domain (1)
(-)
Protein domain: Ligand-dependent corepressor (LCoR) (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2COBA:8-70SOLUTION STRUCTURES OF THE HTH DOMAIN OF HUMAN LCOR PROTEIN
(-)
Family: Recombinase DNA-binding domain (20)
(-)
Protein domain: gamma,delta resolvase (C-terminal domain) (6)
(-)
Escherichia coli [TaxId: 562] (6)
1GDTA:141-183; B:141-183CRYSTAL STRUCTURE OF A SITE-SPECIFIC RECOMBINASE, GAMMA-DELTA RESOLVASE COMPLEXED WITH A 34 BP CLEAVAGE SITE
1RESA:DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION
1RETA:DETERMINATION OF THE STRUCTURE OF THE DNA BINDING DOMAIN OF GAMMA DELTA RESOLVASE IN SOLUTION
1ZR2A:141-183; B:141-183STRUCTURE OF A SYNAPTIC GAMMA-DELTA RESOLVASE TETRAMER COVALENTLY LINKED TO TWO CLEAVED DNAS
1ZR4A:141-183; B:141-183; D:141-183; E:141-183STRUCTURE OF A SYNAPTIC GAMMA-DELTA RESOLVASE TETRAMER COVALENTLY LINKED TO TWO CLEAVED DNAS
2GM4A:141-183; B:141-183AN ACTIVATED, TETRAMERIC GAMMA-DELTA RESOLVASE: HIN CHIMAERA BOUND TO CLEAVED DNA
(-)
Protein domain: HIN recombinase (DNA-binding domain) (8)
(-)
Synthetic (8)
1HCRA:HIN RECOMBINASE BOUND TO DNA: THE ORIGIN OF SPECIFICITY IN MAJOR AND MINOR GROOVE INTERACTIONS
1IJWC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS.
1JJ6C:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS.
1JJ8C:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKOC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKPC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKQC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
1JKRC:TESTING THE WATER-MEDIATED HIN RECOMBINASE DNA RECOGNITION BY SYSTEMATIC MUTATIONS
(-)
Protein domain: Ibeta subdomain of the mu end DNA-binding domain of phage mu transposase (2)
(-)
Bacteriophage Mu [TaxId: 10677] (2)
2EZKA:SOLUTION NMR STRUCTURE OF THE IBETA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF PHAGE MU TRANSPOSASE, REGULARIZED MEAN STRUCTURE
2EZLA:SOLUTION NMR STRUCTURE OF THE IBETA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF PHAGE MU TRANSPOSASE, 29 STRUCTURES
(-)
Protein domain: Transposase (2)
(-)
Bacteriophage Mu [TaxId: 10677] (2)
2EZHA:SOLUTION NMR STRUCTURE OF THE IGAMMA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF MU PHAGE TRANSPOSASE, MINIMIZED AVERAGE STRUCTURE
2EZIA:SOLUTION NMR STRUCTURE OF THE IGAMMA SUBDOMAIN OF THE MU END DNA BINDING DOMAIN OF MU PHAGE TRANSPOSASE, 30 STRUCTURES
(-)
Protein domain: Transposase tc3a1-65 (2)
(-)
Nematode (Caenorhabditis elegans) [TaxId: 6239] (2)
1TC3C:TRANSPOSASE TC3A1-65 FROM CAENORHABDITIS ELEGANS
1U78A:2-54; A:55-104STRUCTURE OF THE BIPARTITE DNA-BINDING DOMAIN OF TC3 TRANSPOSASE BOUND TO TRANSPOSON DNA
(-)
Family: RpiR-like (1)
(-)
Protein domain: Putative transcriptional regulator YbbH (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
2O3FA:1-83; B:; C:STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF THE N-TERMINAL DOMAIN OF THE PUTATIVE TRANSCRIPTIONAL REGULATOR YBBH FROM BACILLUS SUBTILIS SUBSP. SUBTILIS STR. 168.
(-)
Family: SLIDE domain (1)
(-)
Protein domain: SLIDE domain of the nucleosome remodeling ATPase ISWI (1)
(-)
Fruit fly (Drosophila melanogaster) [TaxId: 7227] (1)
1OFCX:851-978NUCLEOSOME RECOGNITION MODULE OF ISWI ATPASE
(-)
Family: SWIRM domain (14)
(-)
Protein domain: automated matches (1)
(-)
Human (Homo sapiens) [TaxId: 9606] (1)
2L3DA:THE SOLUTION STRUCTURE OF THE SHORT FORM SWIRM DOMAIN OF LSD1
(-)
Protein domain: Lysine-specific histone demethylase 1, LSD1 (9)
(-)
Human (Homo sapiens) [TaxId: 9606] (9)
2COMA:8-118THE SOLUTION STRUCTURE OF THE SWIRM DOMAIN OF HUMAN LSD1
2DW4A:172-273CRYSTAL STRUCTURE OF HUMAN LSD1 AT 2.3 A RESOLUTION
2EJRA:172-273LSD1-TRANYLCYPROMINE COMPLEX
2H94A:172-273CRYSTAL STRUCTURE AND MECHANISM OF HUMAN LYSINE-SPECIFIC DEMETHYLASE-1
2IW5A:171-273STRUCTURAL BASIS FOR COREST-DEPENDENT DEMETHYLATION OF NUCLEOSOMES BY THE HUMAN LSD1 HISTONE DEMETHYLASE
2UXNA:173-273STRUCTURAL BASIS OF HISTONE DEMETHYLATION BY LSD1 REVEALED BY SUICIDE INACTIVATION
2UXXA:171-273HUMAN LSD1 HISTONE DEMETHYLASE-COREST IN COMPLEX WITH AN FAD-TRANYLCYPROMINE ADDUCT
2Z3YA:172-273CRYSTAL STRUCTURE OF LYSINE-SPECIFIC DEMETHYLASE1
2Z5UA:172-273CRYSTAL STRUCTURE OF LYSINE-SPECIFIC HISTONE DEMETHYLASE 1
(-)
Protein domain: Transcription regulatory protein swi3 (1)
(-)
Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] (1)
2FQ3A:311-395STRUCTURE AND FUNCTION OF THE SWIRM DOMAIN, A CONSERVED PROTEIN MODULE FOUND IN CHROMATIN REGULATORY COMPLEXES
(-)
Protein domain: Transcriptional adaptor 2-like, TADA2L (3)
(-)
Mouse (Mus musculus) [TaxId: 10090] (3)
2AQEA:2-90STRUCTURAL AND FUNCTIONAL ANALYSIS OF ADA2 ALPHA SWIRM DOMAIN
2AQFA:STRUCTURAL AND FUNCTIONAL ANALYSIS OF ADA2 ALPHA SWIRM DOMAIN
2CUJA:8-108SOLUTION STRUCTURE OF SWIRM DOMAIN OF MOUSE TRANSCRIPTIONAL ADAPTOR 2-LIKE
(-)
Family: Tetracyclin repressor-like, N-terminal domain (97)
(-)
Protein domain: A-factor receptor homolog CprB (2)
(-)
Streptomyces coelicolor [TaxId: 1902] (2)
1UI5A:5-75; B:5-75CRYSTAL STRUCTURE OF GAMMA-BUTYROLACTONE RECEPTOR (ARPA LIKE PROTEIN)
1UI6A:5-75; B:6-75CRYSTAL STRUCTURE OF GAMMA-BUTYROLACTONE RECEPTOR (ARPA-LIKE PROTEIN)
(-)
Protein domain: automated matches (2)
(-)
Bacillus cereus [TaxId: 1396] (2)
2JJ7A:3-76; B:1-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 170-185 SUBSTITUTED BY ALANINE
2JK3A:4-76; B:4-76CRYSTAL STRUCTURE OF THE HLYIIR MUTANT PROTEIN WITH RESIDUES 169-186 SUBSTITUTED BY GSSGSSG LINKER
(-)
Protein domain: Ethr repressor (5)
(-)
Mycobacterium tuberculosis [TaxId: 1773] (5)
1T56A:22-94CRYSTAL STRUCTURE OF TETR FAMILY REPRESSOR M. TUBERCULOSIS ETHR
1U9NA:22-94CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR ETHR IN A LIGAND BOUND CONFORMATION OPENS THERAPEUTIC PERSPECTIVES AGAINST TUBERCULOSIS AND LEPROSY
1U9OA:22-94CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR ETHR IN A LIGAND BOUND CONFORMATION
3TP0A:24-93STRUCTURAL ACTIVATION OF THE TRANSCRIPTIONAL REPRESSOR ETHR FROM M. TUBERCULOSIS BY SINGLE AMINO-ACID CHANGE MIMICKING NATURAL AND SYNTHETIC LIGANDS
3TP3A:22-94STRUCTURE OF HTH-TYPE TRANSCRIPTIONAL REGULATOR ETHR, G106W MUTANT
(-)
Protein domain: Hemolysin II regulatory protein, HlyIIR (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2FX0A:4-76CRYSTAL STRUCTURE OF HLYIIR, A HEMOLYSIN II TRANSCRIPTIONAL REGULATOR
(-)
Protein domain: Hypothetical transcriptional regulator YcdC (2)
(-)
Escherichia coli [TaxId: 562] (2)
3LOCA:11-85; B:11-85; C:12-85; D:11-85CRYSTAL STRUCTURE OF PUTATIVE TRANSCRIPTIONAL REGULATOR YCDC
4JYKA:12-86; B:17-86STRUCTURE OF E. COLI TRANSCRIPTIONAL REGULATOR RUTR WITH BOUND URACIL
(-)
Protein domain: Hypothetical transcriptional regulator YfiR (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1RKTA:2-82; B:6-82CRYSTAL STRUCTURE OF YFIR, A PUTATIVE TRANSCRIPTIONAL REGULATOR FROM BACILLUS SUBTILIS
(-)
Protein domain: Hypothetical transcriptional regulator YsiA (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1VI0A:6-77; B:6-77CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR
(-)
Protein domain: Multidrug binding protein QacR (24)
(-)
Staphylococcus aureus [TaxId: 1280] (24)
1JT0A:2-72; B:2-72; C:2-72; D:2-72CRYSTAL STRUCTURE OF A COOPERATIVE QACR-DNA COMPLEX
1JT6A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING PROTEIN QACR BOUND TO DEQUALINIUM
1JTXA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR QACR BOUND TO CRYSTAL VIOLET
1JTYA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REGULATOR QACR BOUND TO ETHIDIUM
1JUMA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO THE NATURAL DRUG BERBERINE
1JUPA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO MALACHITE GREEN
1JUSA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO RHODAMINE 6G
1QVTA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO THE DRUG PROFLAVINE
1QVUA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO TWO DRUGS: ETHIDIUM AND PROFLAVINE
1RKWA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR QACR BOUND TO PENTAMADINE
1RPWA:2-72; B:2-72; C:2-72; D:2-72CRYSTAL STRUCTURE OF THE MULTIDRUG BINDING PROTEIN QACR BOUND TO THE DIAMIDINE HEXAMIDINE
2DTZA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF MULTIDRUG BINDING PROTEIN QACR FROM STAPHYLOCOCCUS AUREUS COCRYSTALLIZED WITH COMPOUND DB75
2G0EA:2-72; B:2-72; D:2-72; E:2-72STRUCTURE OF QACR MULTIDRUG TRANSCRIPTIONAL REGULATOR BOUND TO TRIVALENT AND BIVALENT DIAMIDINE DRUGS
2GBYA:2-72; B:2-72; D:2-72; E:2-72STRUCTURE OF QACR MULTIDRUG TRANSCRIPTIONAL REGULATOR BOUND TO BIVALENT DIAMIDINE BERENIL
2HQ5A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF MULTIDRUG BINDING PROTEIN QACR FROM STAPHYLOCOCCUS AUREUS COCRYSTALLIZED WITH COMPOUND DB359
3BR0A:2-72; B:4-72CRYSTAL STRUCTURE OF THE COMPLEX OF MALACHITE GREEN BOUND TO QACR(E120Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BR3A:3-72; B:4-72CRYSTAL STRUCTURE OF THE COMPLEX OF ETHIDIUM BOUND TO QACR(E90Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BR5A:2-72; B:3-72; D:4-72; E:2-72CRYSTAL STRUCTURE OF THE COMPLEX OF RHODAMINE 6G BOUND TO QACR(E90Q), A MUTANT OF A MULTIDRUG BINDING TRANSCRIPTIONAL REPRESSOR
3BT9A:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E57Q) BOUND TO DEQUALINIUM
3BTCA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E57Q) BOUND TO MALACHITE GREEN
3BTIA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO BERBERINE
3BTJA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO DEQUALINIUM
3BTLA:2-72; B:2-72; D:2-72; E:2-72CRYSTAL STRUCTURE OF QACR(E58Q) BOUND TO MALACHITE GREEN
3PM1A:3-72; B:1-72STRUCTURE OF QACR E90Q BOUND TO ETHIDIUM
(-)
Protein domain: Probable transcriptional regulator PA1836 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2GENA:6-75STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PROBABLE TRANSCRIPTIONAL REGULATOR FROM PSEUDOMONAS AERUGINOSA PAO1
(-)
Protein domain: Probable transcriptional regulator PA3133 (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2FD5A:1-76THE CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR FROM PSEUDOMONAS AERUGINOSA PAO1
(-)
Protein domain: Probable transcriptional regulator RHA1_ro04631 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2GFNA:4-80; B:7-80CRYSTAL STRUCTURE OF HTH-TYPE TRANSCRIPTIONAL REGULATOR PKSA RELATED PROTEIN FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative regulator SCO4008 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2D6YA:7-74; B:5-74CRYSTAL STRUCTURE OF TRANSCRIPTIONAL FACTOR SCO4008 FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative regulatory protein Sco4313 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2OI8A:8-86CRYSTAL STRUCTURE OF PUTATIVE REGULATORY PROTEIN SCO4313
(-)
Protein domain: Putative transcriptional regulator (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2G3BA:2-73; B:2-73CRYSTAL STRUCTURE OF PUTATIVE TETR-FAMILY TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP.
(-)
Protein domain: Putative transcriptional regulator Atu0279 (1)
(-)
Agrobacterium tumefaciens [TaxId: 358] (1)
2G7SA:3-76THE CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY, FROM AGROBACTERIUM TUMEFACIENS
(-)
Protein domain: Putative transcriptional regulator Rha04620 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2G7GA:9-73THE CRYSTAL STRUCTURE OF THE PUTATIVE TRANSCRIPTIONAL REGULATOR RHA04620 FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator RHA1_ro03468 (1)
(-)
Rhodococcus sp. RHA1 [TaxId: 101510] (1)
2HKUA:18-87; B:19-87STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator RHA1_ro09068 (1)
(-)
Rhodococcus sp. [TaxId: 1831] (1)
2I10A:10-78; B:11-78PUTATIVE TETR TRANSCRIPTIONAL REGULATOR FROM RHODOCOCCUS SP. RHA1
(-)
Protein domain: Putative transcriptional regulator SCO0857 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2NP3A:35-99; B:22-99CRYSTAL STRUCTURE OF TETR-FAMILY REGULATOR (SCO0857) FROM STREPTOMYCES COELICOLOR A3.
(-)
Protein domain: Putative transcriptional regulator SCO4850 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
3C07A:15-89; B:16-89CRYSTAL STRUCTURE OF A TETR FAMILY TRANSCRIPTIONAL REGULATOR FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative transcriptional regulator SCO4940 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2HYJA:8-82THE CRYSTAL STRUCTURE OF A TETR-FAMILY TRANSCRIPTIONAL REGULATOR FROM STREPTOMYCES COELICOLOR
(-)
Protein domain: Putative transcriptional regulator SCO5951 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2ID3A:13-80; B:14-80CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR SCO5951 FROM STREPTOMYCES COELICOLOR A3(2)
(-)
Protein domain: Putative transcriptional regulator SCO7704 (1)
(-)
Streptomyces coelicolor [TaxId: 1902] (1)
2G7LA:16-83CRYSTAL STRUCTURE OF PUTATIVE TRANSCRIPTION REGULATOR SCO7704 FROM STREPTOMYCES COELICOR
(-)
Protein domain: Putative transcriptional regulator YxaF (1)
(-)
Bacillus subtilis [TaxId: 1423] (1)
1SGMA:5-77; B:5-77CRYSTAL STRUCTURE OF HYPOTHETICAL PROTEIN YXAF
(-)
Protein domain: Putative transcriptional repressor YbiH (1)
(-)
Salmonella typhimurium [TaxId: 90371] (1)
1T33A:1-88; B:7-88STRUCTURAL GENOMICS, THE CRYSTAL STRUCTURE OF A PUTATIVE TRANSCRIPTIONAL REPRESSOR (TETR/ACRR FAMILY) FROM SALMONELLA TYPHIMURIM LT2
(-)
Protein domain: Tetracyclin repressor (Tet-repressor, TetR) (24)
(-)
Escherichia coli [TaxId: 562] (24)
1A6IA:2-67TET REPRESSOR, CLASS D VARIANT
1BJ0  [entry was replaced by entry 4V2F without any SCOP domain information]
1BJY  [entry was replaced by entry 4V2G without any SCOP domain information]
1BJZA:2-67TETRACYCLINE CHELATED MG2+-ION INITIATES HELIX UNWINDING FOR TET REPRESSOR INDUCTION
1ORKA:2-67TET REPRESSOR, CLASS D IN COMPLEX WITH 9-(N,N-DIMETHYLGLYCYLAMIDO)-6-DEMETHYL-6-DEOXY-TETRACYCLINE
1QPIA:4-67CRYSTAL STRUCTURE OF TETRACYCLINE REPRESSOR/OPERATOR COMPLEX
2FJ1A:2-67CRYSTAL STRUCTURE ANALYSIS OF TET REPRESSOR (CLASS D) IN COMPLEX WITH 7-CHLORTETRACYCLINE-NICKEL(II)
2NS7A:5-67; B:3-67; C:7-67; D:4-67HOW AN IN VITRO SELECTED PEPTIDE MIMICS THE ANTIBIOTIC TETRACYCLINE TO INDUCE TET REPRESSOR
2O7OA:2-67CRYSTAL STRUCTURE ANALYSIS OF TETR(D) COMPLEX WITH DOXYCYCLINE
2TCTA:2-67THE COMPLEX FORMED BETWEEN TET REPRESSOR AND TETRACYCLINE-MG2+ REVEALS MECHANISM OF ANTIBIOTIC RESISTANCE
2TRTA:2-67TETRACYCLINE REPRESSOR CLASS D
2VKEA:2-67TET REPRESSOR CLASS D COMPLEXED WITH COBALT AND TETRACYCLINE
2X6OA:2-67TET REPRESSOR CLASS D IN COMPLEX WITH 7-CHLOR-2-CYANO-ISO-TETRACYCLINE
2X9DA:2-67TET REPRESSOR (CLASS D) IN COMPLEX WITH ISO-7 CHLORTETRACYCLINE
2XB5A:2-67TET REPRESSOR (CLASS D) IN COMPLEX WITH 7-IODOTETRACYCLINE
2XPS  [entry was replaced by entry 4D7M without any SCOP domain information]
2XPT  [entry was replaced by entry 4D7N without any SCOP domain information]
2XPUA:2-67TETR(D) IN COMPLEX WITH ANHYDROTETRACYCLINE.
2XPVA:2-67TETR(D) IN COMPLEX WITH MINOCYCLINE AND MAGNESIUM.
2XPWA:2-67TETR(D) IN COMPLEX WITH OXYTETRACYCLINE AND MAGNESIUM.
3FK6A:4-67; B:3-67CRYSTAL STRUCTURE OF TETR TRIPLE MUTANT (H64K, S135L, S138I)
3FK7A:4-67; B:4-67CRYSTAL STRUCTURE OF TETR TRIPLE MUTANT (H64K, S135L, S138I) IN COMPLEX WITH 4-DDMA-ATC
4ABZA:2-67TETR(D) IN COMPLEX WITH TIGECYCLINE AND MAGNESIUM
4AUXA:2-67TET REPRESSOR CLASS D IN COMPLEX WITH 9-NITROTETRACYCLINE
(-)
Protein domain: Transcriptional activator DhaS (1)
(-)
Lactococcus lactis [TaxId: 1358] (1)
2IU5A:1-71; B:4-71DIHYDROXYACETONE KINASE OPERON ACTIVATOR DHAS
(-)
Protein domain: Transcriptional regulator BC3163 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
2FQ4A:9-77THE CRYSTAL STRUCTURE OF THE TRANSCRIPTIONAL REGULATOR (TETR FAMILY) FROM BACILLUS CEREUS
(-)
Protein domain: Transcriptional regulator BC5000 (1)
(-)
Bacillus cereus [TaxId: 1396] (1)
1ZK8A:6-77; B:8-77CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR FROM BACILLUS CEREUS ATCC 14579
(-)
Protein domain: Transcriptional regulator Cgl1640/Cg1846 (1)
(-)
Corynebacterium glutamicum [TaxId: 1718] (1)
2O7TA:1-78CRYSTAL STRUCTURE OF A TETR FAMILY TRANSCRIPTIONAL REGULATOR (NCGL1578, CGL1640) FROM CORYNEBACTERIUM GLUTAMICUM AT 2.10 A RESOLUTION
(-)
Protein domain: Transcriptional regulator Cgl2612 (3)
(-)
Corynebacterium glutamicum [TaxId: 1718] (3)
2YVEA:1-74; B:3-74CRYSTAL STRUCTURE OF THE METHYLENE BLUE-BOUND FORM OF THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR
2ZOYA:1-74; B:3-74THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR (CGL2612 PROTEIN) FROM C.GLUTAMICUM
2ZOZA:3-73; B:1-73CRYSTAL STRUCTURE OF THE ETHIDIUM-BOUND FORM OF THE MULTI-DRUG BINDING TRANSCRIPTIONAL REPRESSOR CGMR
(-)
Protein domain: Transcriptional regulator EF0787 (1)
(-)
Enterococcus faecalis [TaxId: 1351] (1)
1Z0XA:4-71; B:3-71CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY FROM ENTEROCOCCUS FAECALIS V583
(-)
Protein domain: Transcriptional regulator PsrA (1)
(-)
Pseudomonas aeruginosa [TaxId: 287] (1)
2FBQA:2-80THE CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR PA3006
(-)
Protein domain: Transcriptional regulator RHA1_ro04179 (1)
(-)
Rhodococcus sp. [TaxId: 1831] (1)
2NP5A:9-77; B:9-77; C:10-77; D:10-77CRYSTAL STRUCTURE OF A TRANSCRIPTIONAL REGULATOR (RHA1_RO04179) FROM RHODOCOCCUS SP. RHA1.
(-)
Protein domain: Transcriptional regulator TM1030 (8)
(-)
Thermotoga maritima [TaxId: 2336] (8)
1Z77A:1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR PROTEIN FROM THERMOTOGA MARITIMA.
1ZKGA:2-75; B:2-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR, TETR FAMILY (TM1030) FROM THERMOTOGA MARITIMA AT 2.30 A RESOLUTION
2ID6A:-1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR (TM1030) AT 1.75A RESOLUTION
2IEKA:2-75NEW CRYSTAL FORM OF TRANSCRIPTIONAL REGULATOR TM1030 FROM THERMOTOGA MARITIMA
3IH2A:0-75TM1030 CRYSTALLIZED AT 323K
3IH3A:-1-75TM1030 CRYSTALLIZED AT 310K
3IH4A:-1-75TM1030 CRYSTALLIZED AT 277K
4I76A:3-75; B:1-75CRYSTAL STRUCTURE OF TRANSCRIPTIONAL REGULATOR TM1030 WITH OCTANOL