SCOP Search:   
        by sunid, keyword
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(use 'Shift Left-Click' to collapse/expand all levels downwards; use 'Control Left-Click' to collapse/expand all levels upwards)
 
(-)
Class: All alpha proteins (14657)
(-)
Fold: DNA/RNA-binding 3-helical bundle (1299)
(-)
Superfamily: Homeodomain-like (373)
(-)
Family: FIS-like (34)
(-)
Protein domain: FIS protein (31)
(-)
Escherichia coli K-12 [TaxId: 83333] (15)
3IV5A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F1
3JR9A:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP OPTIMAL BINDING SEQUENCE F2
3JRAA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP NON CONSENSUS SEQUENCE DNA F6
3JRBA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F24 CONTAINING T-TRACT AT CENTER
3JRCA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F29 CONTAINING 5 G/CS AT CENTER
3JRDA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F25 CONTAINING T2A3 SEQUENCE AT CENTER
3JREA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F26 CONTAINING A-TRACT AT CENTER
3JRFA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP DNA F27 CONTAINING A C/G AT CENTER
3JRGA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F18
3JRHA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F21
3JRIA:; B:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP NON CONSENSUS SEQUENCE DNA F23
4IHVB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
4IHWB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP INOSINE SUBSTITUTED DNA F28-DI (AAATTTGTTTGAICITTGAGCAAATTT)
4IHXB:CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP 2-AMINOPURINE SUBSTITUTED DNA F28-2AP (AAATTTGTTTGA2T2TTGAGCAAATTT)
4IHYB:CRYSTAL STRUCTURE OF FIS BOUND TO 27BP INOSINE SUBSTITUTED DNA F29-DI (AAATTTGTTTGIICICTGAGCAAATTT)