Select entry :   
(by PDB/NDB code)           

 Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:1122
 aligned with ADDA_BACSU | P23478 from UniProtKB/Swiss-Prot  Length:1232

    Alignment length:1223
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339       349       359       369       379       389       399       409       419       429       439       449       459       469       479       489       499       509       519       529       539       549       559       569       579       589       599       609       619       629       639       649       659       669       679       689       699       709       719       729       739       749       759       769       779       789       799       809       819       829       839       849       859       869       879       889       899       909       919       929       939       949       959       969       979       989       999      1009      1019      1029      1039      1049      1059      1069      1079      1089      1099      1109      1119      1129      1139      1149      1159      1169      1179      1189      1199      1209      1219      1229   
          ADDA_BACSU     10 TWTDDQWNAIVSTGQDILVAAAAGSGKTAVLVERMIRKITAEENPIDVDRLLVVTFTNASAAEMKHRIAEALEKELVQRPGSLHIRRQLSLLNRASISTLHSFCLQVLKKYYYLIDLDPGFRIADQTEGELIGDEVLDELFEDEYAKGEKAFFELVDRYTTDRHDLDLQFLVKQVYEYSRSHPNPEAWLESFVHLYDVSEKSAIEELPFYQYVKEDIAMVLNGAKEKLLRALELTKAPGGPAPRADNFLDDLAQIDELIQHQDDFSELYKRVPAVSFKRAKAVKGDEFDPALLDEATDLRNGAKKLLEKLKTDYFTRSPEQHLKSLAEMKPVIETLVQLVISYGKRFEAAKQEKSIIDFSDLEHYCLAILTAENDKGEREPSEAARFYQEQFHEVLVDEYQDTNLVQESILQLVTSGPEETGNLFMVGDVKQSIYRFRLAEPLLFLSKYKRFTESGEGTGRKIDLNKNFRSRADILDSTNFLFKQLMGGKIGEVDYDEQAELKLGAAYPDNDETETELLLIDNAEDTDASEEAEELETVQFEAKAIAKEIRKLISSPFKVYDGKKKTHRNIQYRDIVILLRSMPWAPQIMEELRAQGIPVYANLTSGYFEAVEVAVALSVLKVIDNPYQDIPLASVLRSPIVGADENELSLIRLENKKAPYYEAMKDYLAAGDRSDELYQKLNTFYGHLQKWRAFSKNHSVSELIWEVYRDTKYMDYVGGMPGGKQRQANLRVLYDRARQYESTAFRGLFRFLRFIERMQERGDDLGTARALSEQEDVVRLMTIHSSKGLEFPVVFVAGLGRNFNMMDLNKSYLLDKELGFGTKYIHPQLRISYPTLPLIAMKKKMRRELLSEELRVLYVALTRAKEKLFLIGSCKDHQKQLAKWQASASQTDWLLPEFDRYQARTYLDFIGPALARHRDLGDLAGVPAHADISGHPARFAVQMIHSYDLLDDDLEERMEEKSERLEAIRRGEPVPGSFAFDEKAREQLSWTYPHQEVTQIRTKQSVSEIKRKREYEDEYSGRAPVKPADGSILYRRPAFMMKKGLTAAEKGTAMHTVMQHIPLSHVPSIEEAEQTVHRLYEKELLTEEQKDAIDIEEIVQFFHTEIGGQLIGAKWKDREIPFSLALPAKEIYPDAHEADEPLLVQGIIDCLYETEDGLYLLDYKSDRIEGKFQHGFEGAAPILKKRYETQIQLYTKAVEQIAKTKVKGCALYFFDGGHILTL 1232
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhh....eeeee....hhhhhhhhhhhhhhh......hhh.eeeee.hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhh...eeeehhhhhhhhhhhhhhhh......ee.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhh...hhhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhhhhhhhhh----------.hhhhhhhhhhhhhhh..hhhhhhhhh....------------.hhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.eehhhhhhhhhhhhhh....---...hhhhhhhhhhh.eeee.hhhhhhhhhhhhhhhhh........eeeeehhhhh.......hhhhhhhhhhhh........eeeee.ee...hhhhhhhhhhhhhhhhhhhhhh.........ee...........eeeeee.-------------.hhhhhhhhhhhhhhhhhhhh.....---...........eeeee....hhhhhhhhhhhh...eee........hhhhhhhhhhhhhhhh..hhhhhhhhhh......hhhhhhhhhhhh...hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhh..----------....eeeee.hhh....eeeeee...............eeee...eeeeeeee....eeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhheeeeeeeeee..hhhhhhhhhhhhh.......hhhhhhh...hhhhhhhhhhh..----------.hhhhhh...eeeeee....-------------.hhhhhhh.....---..hhhhhhhhhh....hhhhh....eeee.---------...ee.-----------............hhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeeeeeeee.hhh.........eeeeeeeeeeeee....eeeeeee......----...hhhhhhhhhhhhhhhhhhhhhhhhhh..eeeeeeee....eeeee Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                PROSITE (2) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UVRD_HELICASE_CTER  PDB: A:508-798 UniProt: 508-798                                                                                                                                                                                                                                                -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE (2)
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3U44 A   10 TWTDDQWNAIVSTGQDILVAAAAGSGKTAVLVERMIRKITAEENPIDVDRLLVVTFTNASAAEMKHRIAEALEKELVQRPGSLHIRRQLSLLNRASISTLHSFCLQVLKKYYYLIDLDPGFRIADQTEGELIGDEVLDELFEDEYAKGEKAFFELVDRYTTDRHDLDLQFLVKQVYEYSRSHPNPEAWLESFVHLYDVSEKSAIEELPFYQYVKEDIAMVLNGAKEKLLRALELT----------DNFLDDLAQIDELIQHQDDFSELYKRVPAVS------------DPALLDEATDLRNGAKKLLEKLKTDYFTRSPEQHLKSLAEMKPVIETLVQLVISYGKRFEAAKQEKSIIDFSDLEHYCLAILTAEND---REPSEAARFYQEQFHEVLVDEYQDTNLVQESILQLVTSGPEETGNLFMVGDVKQSIYRFRLAEPLLFLSKYKRFTESGEGTGRKIDLNKNFRSRADILDSTNFLFKQLMGGKIGEVDYDEQAELKLGAAYPDNDETETELLLID-------------LETVQFEAKAIAKEIRKLISSPFKVY---KKTHRNIQYRDIVILLRSMPWAPQIMEELRAQGIPVYANLTSGYFEAVEVAVALSVLKVIDNPYQDIPLASVLRSPIVGADENELSLIRLENKKAPYYEAMKDYLAAGDRSDELYQKLNTFYGHLQKWRAFSKNHSVSELIWEVYRDTKYMDYVGGMPGGKQRQANLRVLYDRARQYESTAFRGLFRFLRFIERMQERGD----------QEDVVRLMTIHSSKGLEFPVVFVAGLGRNFNMMDLNKSYLLDKELGFGTKYIHPQLRISYPTLPLIAMKKKMRRELLSEELRVLYVALTRAKEKLFLIGSCKDHQKQLAKWQASASQTDWLLPEFDRYQARTYLDFIGPALARHR----------HADISGHPARFAVQMIHSYD-------------SERLEAIRRGEPV---FAFDEKAREQLSWTYPHQEVTQIRTKQSVS---------DEYSGR-----------YRRPAFMMKKGLTAAEKGTAMHTVMQHIPLSHVPSIEEAEQTVHRLYEKELLTEEQKDAIDIEEIVQFFHTEIGGQLIGAKWKDREIPFSLALPAKEIYPDAHEADEPLLVQGIIDCLYETEDGLYLLAYKSDRIEG----GFEGAAPILKKRYETQIQLYTKAVEQIAKTKVKGCALYFFDGGHILTL 1232
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239    |    -     | 259       269       279     |   -       299       309       319       329       339       349       359       369       379    |  389       399       409       419       429       439       449       459       469       479       489       499       509       519       529 |       -     | 549       559       569|   |  579       589       599       609       619       629       639       649       659       669       679       689       699       709       719       729       739       749       759       769   |     -    |  789       799       809       819       829       839       849       859       869       879       889       899       909       919        |-       939       949        |-         -  |    979    |  989       999      1009       | -      1029  |      -    | 1049      1059      1069      1079      1089      1099      1109      1119      1129      1139      1149      1159      1169      1179|    |1189      1199      1209      1219      1229   
                                                                                                                                                                                                                                                                    244        255                           285          298                                                                                   384 388                                                                                                                                            531           545                      570 574                                                                                                                                                                                                    773        784                                                                                                                                             928        939                958           972         984 988                         1017      1027 1032        1044                                                                                                                                    1180 1185                                               

Chain B from PDB  Type:PROTEIN  Length:1141
 aligned with ADDB_BACSU | P23477 from UniProtKB/Swiss-Prot  Length:1166

    Alignment length:1159
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111      1121      1131      1141      1151         
          ADDB_BACSU      2 GAEFLVGRSGSGKTKLIINSIQDELRRAPFGKPIIFLVPDQMTFLMEYELAKTPDMGGMIRAQVFSFSRLAWRVLQHTGGMSRPFLTSTGVQMLLRKLIEEHKQEFKVYQKASDKSGFTAQVERMLTEFKRYCLEPEDIRRMAESGTASEYRGERVLSEKLHDLSILYQQMEKSLADQYLHSEDYLTLLAEHIPLAEDIKGAHIYVDGFYQFTPQEFRVLEQLMVHAEHITFSLTADKPSYEREPHELELFRMTGKTYYRLHQKAKELNLDITYKELSGTERHTKTPELAHLEAQYEARPAIPYAEKQEALTVMQAANRRAELEGIAREIHALVREKGYRYKDVAILARQPEDYKDMVKEVFADYEIPYFIDGKASMLNHPLIEFIRSSLDVLKGNWRYEAVFRCVKTELLFPLNEPKAKVREQVDQLENYCIAYGIKGDRWTKGDRFQYRRFVSLDDDFAQTDQEIEMENMLNDTRDWIVPPLFQLQKRMKKAKTVQEKAEALYRYLEETDVPLKLDQERQRAEDDGRIIEAQQHQQAWDAVIQLLEEFVEMMGDDEISLDLFQQMIEAGAESLTFSLIPPALDQVFVGNMDLSRMYGTSCTFVLGANDGVLPARPDENGVLSDDDREWLKTIGVELSSGGRERLLDEHFLIYMAFSSPSDRLYVSYPIADAEGKTLLPSMIVKRLEELFPHHKERLLTNEPEQVSDEEQLMYVVNKSVAQSFTASQLRLWTREYDISDVWWSTYNVLMSEQDRLQSKKLFSSLFFRNEVKQLERSVSRQLYGERIQGSVSRMETFNACPFSHFASHGLHLKERQFFKLEAPDIGQLFHSSLKLISDRLREQKLDWRDLTKEQCELFSYDAVERLAPKLQKEILLSSNRHYYVKEKLQKIVTRVSGILSEHAKASGFVPIGLELGFGGKGPLPPLTFQLKNGCTMELVGRIDRVDKAESSKGLLLRIVDYKSSDKGLDLAEVYYGLALQMLTYLDLSITHSADWLGMRATPAGVLYFHIHDPMIQSNLPLGLDEIEQEIFKKFKMKGLLLGDQEVVRLMDTTLQEGRSNIINAGLKKDGSLRSDSAAVGEKEFDLLTKHVRRTFQEAGEQITDGRVSIEPYKMKNKTPCTYCAFKSVCQFDESLEENEYRPLKAEKDKTILEWIKKEA 1160
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .eeeeee....hhhhhhhhhhhhhhhhh.....eeee.hhhhhhhhhhhhh......ee..eeeehhhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhhhh..hhhhhhhhhh........hhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhh.........eeee......hhhhhhhhhhhhhhh.eeeeeee...............hhhhhhhhhhhhhhhhhh...eeeeee........hhhhhhhhhhh..............eeeeee.hhhhhhhhhhhhhhhhhhh...hhh.eeeee.hhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhhhhhh..hhhhhhhhhh.........hhhhhhhhhhhhhhhhhhh...hhhhhh------------------.hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhh...........eeeee..........eeeee.................hhhhhhhhhh.........hhhhhhhhhhhhhhhh....eeeeeee...........hhhhhhhhhhh....eeee..hhhhhhhhhhh....hhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhh.....hhhhhhhhhhhhhhhhhhh............hhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eeeeeeeee........eeeee...eeeee.eeeeeeeeeee..eeeeeeeeee......hhhhhhh...hhhhhhhhhhhhhhhhhhh...eeeeeeeee.....ee.....hhhhhhhhhhhh...eeeee.hhhhhhhhh.....ee......ee...........eehhhhhhhhhhhhhhhhhhhhhhhhh.......ee...........hhhhhh..........ee....hhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------UVRD_HELICASE_CTER  PDB: B:281-586 UniProt: 281-586                                                                                                                                                                                                                                                               ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                3U44 B    2 GAEFLVGRSGSGKTKLIINSIQDELRRAPFGKPIIFLVPDQMTFLMEYELAKTPDMGGMIRAQVFSFSRLAWRVLQHTGGMSRPFLTSTGVQMLLRKLIEEHKQEFKVYQKASDKSGFTAQVERMLTEFKRYCLEPEDIRRMAESGTASEYRGERVLSEKLHDLSILYQQMEKSLADQYLHSEDYLTLLAEHIPLAEDIKGAHIYVDGFYQFTPQEFRVLEQLMVHAEHITFSLTADKPSYEREPHELELFRMTGKTYYRLHQKAKELNLDITYKELSGTERHTKTPELAHLEAQYEARPAIPYAEKQEALTVMQAANRRAELEGIAREIHALVREKGYRYKDVAILARQPEDYKDMVKEVFADYEIPYFIDGKASMLNHPLIEFIRSSLDVLKGNWRYEAVFRCVKTELLFPLNEPKAKVREQVDQLENYCIAYGIKGDRWTK------------------TDQEIEMENMLNDTRDWIVPPLFQLQKRMKKAKTVQEKAEALYRYLEETDVPLKLDQERQRAEDDGRIIEAQQHQQAWDAVIQLLEEFVEMMGDDEISLDLFQQMIEAGAESLTFSLIPPALDQVFVGNMDLSRMYGTSCTFVLGANDGVLPARPDENGVLSDDDREWLKTIGVELSSGGRERLLDEHFLIYMAFSSPSDRLYVSYPIADAEGKTLLPSMIVKRLEELFPHHKERLLTNEPEQVSDEEQLMYVVNKSVAQSFTASQLRLWTREYDISDVWWSTYNVLMSEQDRLQSKKLFSSLFFRNEVKQLERSVSRQLYGERIQGSVSRMETFNACPFSHFASHGLHLKERQFFKLEAPDIGQLFHSSLKLISDRLRDEKLDWRDLTKEQCELFSYDAVERLAPKLQKEILLSSNRHYYVKEKLQKIVTRVSGILSEHAKASGFVPIGLELGFGGKGPLPPLTFQLKNGCTMELVGRIDRVDKAESSKGLLLRIVAYKSSDKGLDLAEVYYGLALQMLTYLDLSITHSADWLGMRATPAGVLYFHIHDPMIQSNLPLGLDEIEQEIFKKFKMKGLLLGDQEVVRLMDTTLQEGRSNIINAGLKKDGSLRSDSAAVGEKEFDLLTKHVRRTFQEAGEQITDGRVSIEPYKMKNKTPCTYCAFKSVCQFDESLEENEYRPLKAEKDKTILEWIKKEA 1160
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441   |     -         -  |    471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111      1121      1131      1141      1151         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     445                464                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        

Chain X from PDB  Type:DNA  Length:36
                                                                     
                3U44 X    1 TCTAATGCGAGCACTGCAGTGCTCGCATTAGATTTT   47
                                    10     || 31        41      
                                          16|                   
                                           28                   

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'