Select entry :   
(by PDB/NDB code)           

 Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:332
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:332
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    10 NLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1ouqa1 A:10-129 Cre recombinase                                                                                        d1ouqa2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ----------1ouqA02 A:20-130  [code=1.10.150.130, no name defined]                                                         -1ouqA01 A:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.ee.......eee.............eee.hhhhhhhhhhhhhhhh...........................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh...hhhhhhhh..hhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1OUQ A  10 NLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain B from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1ouqb1 B:20-129 Cre recombinase                                                                              d1ouqb2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1ouqB02 B:20-130  [code=1.10.150.130, no name defined]                                                         -1ouqB01 B:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhh......hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhh...........eee....eeeeee....hhhhhhhhhhhhhhhh...........................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhh.hhhhhhhh....hhhhhhhhh........hhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1OUQ B  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain C from PDB  Type:DNA  Length:16
                                                
                 1OUQ C 100 CGATAACuTCGTATAa 115
                                   109     |
                                 107-UMP 115-A3P

Chain D from PDB  Type:DNA  Length:37
                                                                     
                 1OUQ D 100 GGATAACTTCGTATAGCATACATTATACGAAGTTATC 136
                                   109       119       129       

Chain E from PDB  Type:PROTEIN  Length:321
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:321
                                    30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340 
            RECR_BPP1    21 DEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1ouqe1 E:21-129 Cre recombinase                                                                             d1ouqe2 E:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1ouqE02 E:21-130  [code=1.10.150.130, no name defined]                                                        -1ouqE01 E:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhhh..........hhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhh.ee...ee.ee.............ee...hhhhhhhhhhhhhh............................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhh.hhhhhhhhhh...hhhhhhhhh..hhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1OUQ E  21 DEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340 

Chain F from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1ouqf1 F:20-129 Cre recombinase                                                                              d1ouqf2 F:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1ouqF02 F:20-130  [code=1.10.150.130, no name defined]                                                         -1ouqF01 F:132-334 Intergrase catalytic core                                                                                                                                                                ------- CATH domains
           Pfam domains (1) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1ouqF01 F:138-331                                                                                                                                                                 ---------- Pfam domains (1)
           Pfam domains (2) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1ouqF02 F:138-331                                                                                                                                                                 ---------- Pfam domains (2)
           Pfam domains (3) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1ouqF03 F:138-331                                                                                                                                                                 ---------- Pfam domains (3)
           Pfam domains (4) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1ouqF04 F:138-331                                                                                                                                                                 ---------- Pfam domains (4)
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhh.hhh.eee.....eeeeeee....eeeeeeee..hhhhhhhhhhhhhhhh...........................hhhhhhhhhhhhhhhhh...............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhh.........hhhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1OUQ F  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain G from PDB  Type:DNA  Length:16
                                                
                 1OUQ G 100 CGATAACuTCGTATAa 115
                                   109     |
                                 107-UMP 115-A3P

Chain H from PDB  Type:DNA  Length:37
                                                                     
                 1OUQ H 100 GGATAACTTCGTATAGCATACATTATACGAAGTTATC 136
                                   109       119       129       

Chain X from PDB  Type:DNA  Length:21
                                                     
                 1OUQ X 116 TGTATGCTATACGAAGTTATC 136
                                   125       135 

Chain Y from PDB  Type:DNA  Length:21
                                                     
                 1OUQ Y 116 TGTATGCTATACGAAGTTATC 136
                                   125       135 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'