Select entry :   
(by PDB/NDB code)           

 Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:162
 aligned with PPO1_PHYPO | Q94702 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:162
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161  
               SCOP domains d1cyqa_ A: Intron-encoded homing endonuclease I-PpoI                                                                                                               SCOP domains
               CATH domains 1cyqA00 A:2-163 Homing Intron 3 (I-ppo) Encoded Endonuclease; Chain A                                                                                              CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161  

Chain B from PDB  Type:PROTEIN  Length:162
 aligned with PPO1_PHYPO | Q94702 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:162
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161  
               SCOP domains d1cyqb_ B: Intron-encoded homing endonuclease I-PpoI                                                                                                               SCOP domains
               CATH domains 1cyqB00 B:202-363 Homing Intron 3 (I-ppo) Encoded Endonuclease; Chain A                                                                                            CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                                   211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361  

Chain C from PDB  Type:DNA  Length:21
                 1CYQ C 401 TTGACTCTCTTAAGAGAGTCA 421
                                   410       420 

Chain D from PDB  Type:DNA  Length:21
                 1CYQ D 501 TTGACTCTCTTAAGAGAGTCA 521
                                   510       520 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'