Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  S. E. Lietzke, C. E. Kundrot, C. L. Barnes
Date :  14 Apr 98  (Deposition) - 26 Aug 03  (Release) - 24 Feb 09  (Revision)
Resolution :  3.10
Chains :  Asym./Biol. Unit :  A
Keywords :  Rna Pseudoknot (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  S. E. Lietzke, C. L. Barnes, V. F. Malone, J. T. Jones, C. E. Kundrot
The Structure Of An Rna Pseudoknot Shows 3D Domain Swapping
Structure, Motion, V. 10 91 1998 Interaction And Expression Of Biological Macromolecules, The Proceedings Of The Tenth Conversation Held At The University-Suny, Albany Ny, June 17-21, 1997
PubMed: search
(for further references see the PDB file header)

(-) Compounds

    Other Details26-MER

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit A

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 387D)

(-) Sites  (0, 0)

(no "Site" information available for 387D)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 387D)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 387D)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 387D)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 387D)

(-) Exons   (0, 0)

(no "Exon" information available for 387D)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:RNA  Length:26
                  387d A  1 UCCGAAGUGCAACGGGAAAAUGCACU 26
                                    10        20      

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 387D)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 387D)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 387D)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 387D)


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 387d)
(no "Sites" information available for 387d)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 387d)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP | HSSP
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 387D)

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 387D)