Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
(-)Biological Unit 3
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)
Image Biological Unit 3
Biological Unit 3  (Jmol Viewer)

(-) Description

Authors :  C. Oubridge, N. Ito, P. R. Evans, C. -H. Teo, K. Nagai
Date :  04 Jan 95  (Deposition) - 08 Mar 96  (Release) - 13 Jul 11  (Revision)
Resolution :  1.92
Chains :  Asym. Unit :  A,B,C,P,Q,R
Biol. Unit 1:  A,P  (1x)
Biol. Unit 2:  B,Q  (1x)
Biol. Unit 3:  C,R  (1x)
Keywords :  Protein-Rna Complex, Single Strand, Overhanging Base, Hairpin Loop, Transcription-Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  C. Oubridge, N. Ito, P. R. Evans, C. H. Teo, K. Nagai
Crystal Structure At 1. 92 A Resolution Of The Rna-Binding Domain Of The U1A Spliceosomal Protein Complexed With An Rn Hairpin.
Nature V. 372 432 1994
PubMed-ID: 7984237  |  Reference-DOI: 10.1038/372432A0

(-) Compounds

Molecule 1 - RNA (5'- R(*AP*AP*UP*CP*CP*AP*UP*UP*GP*CP*AP*CP*UP*CP*CP*GP*G P*AP*UP*UP*U)- 3')
    ChainsP, Q, R
Molecule 2 - PROTEIN (U1A)
    ChainsA, B, C
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System GeneU1A (2-98, Y31H, Q36R)
    Expression System PlasmidPKN172
    Expression System StrainBL21 (DE3)
    Expression System Taxid469008
    Organism CommonHUMAN
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606

 Structural Features

(-) Chains, Units

Asymmetric Unit ABCPQR
Biological Unit 1 (1x)A  P  
Biological Unit 2 (1x) B  Q 
Biological Unit 3 (1x)  C  R

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 5)

Asymmetric Unit (2, 5)
No.NameCountTypeFull Name
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
Biological Unit 2 (1, 2)
No.NameCountTypeFull Name
Biological Unit 3 (1, 2)
No.NameCountTypeFull Name

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
3AC3SOFTWAREARG B:36 , HOH B:5007 , PHE C:37 , GLU C:61 , SER C:64 , HOH C:4026 , HOH C:4060BINDING SITE FOR RESIDUE GOL B 3000
4AC4SOFTWAREPRO B:76 , ASN C:15 , ASN C:16 , ARG C:83 , HOH C:4006 , HOH C:4012 , HOH C:4017 , U R:8 , HOH R:101 , HOH R:107BINDING SITE FOR RESIDUE GOL C 4000

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1URN)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1URN)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1URN)

(-) PROSITE Motifs  (1, 3)

Asymmetric Unit (1, 3)
1RRMPS50102 Eukaryotic RNA Recognition Motif (RRM) profile.SNRPA_HUMAN10-89
Biological Unit 1 (1, 1)
1RRMPS50102 Eukaryotic RNA Recognition Motif (RRM) profile.SNRPA_HUMAN10-89
Biological Unit 2 (1, 1)
1RRMPS50102 Eukaryotic RNA Recognition Motif (RRM) profile.SNRPA_HUMAN10-89
Biological Unit 3 (1, 1)
1RRMPS50102 Eukaryotic RNA Recognition Motif (RRM) profile.SNRPA_HUMAN10-89

(-) Exons   (3, 9)

Asymmetric Unit (3, 9)
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:96
 aligned with SNRPA_HUMAN | P09012 from UniProtKB/Swiss-Prot  Length:282

    Alignment length:96
                                    11        21        31        41        51        61        71        81        91      
               SCOP domains d1urna_ A: Splicesomal U1A protein                                                               SCOP domains
               CATH domains 1urnA00 A:2-97  [code=, no name defined]                                              CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author .........eeeee.......hhhhhhhhhhhhhhh..eeeeee.........eeeee..hhhhhhhhhhh..........eeee.....hhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE --------RRM  PDB: A:10-89 UniProt: 10-89                                                -------- PROSITE
           Transcript 1 (1) Exon 1.1  PDB: A:2-25   ---------------------------------------------------------Exon 1.3        Transcript 1 (1)
           Transcript 1 (2) -----------------------Exon 1.2  PDB: A:25-82 UniProt: 25-82                     --------------- Transcript 1 (2)
                                    11        21        31        41        51        61        71        81        91      

Chain B from PDB  Type:PROTEIN  Length:96
 aligned with SNRPA_HUMAN | P09012 from UniProtKB/Swiss-Prot  Length:282

    Alignment length:96
                                    11        21        31        41        51        61        71        81        91      
               SCOP domains d1urnb_ B: Splicesomal U1A protein                                                               SCOP domains
               CATH domains 1urnB00 B:2-97  [code=, no name defined]                                              CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author .........eeeee.......hhhhhhhhhhhhhhh..eeeeee.........eeeee..hhhhhhhhhhh..........eeee.....hhhh.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE --------RRM  PDB: B:10-89 UniProt: 10-89                                                -------- PROSITE
           Transcript 1 (1) Exon 1.1  PDB: B:2-25   ---------------------------------------------------------Exon 1.3        Transcript 1 (1)
           Transcript 1 (2) -----------------------Exon 1.2  PDB: B:25-82 UniProt: 25-82                     --------------- Transcript 1 (2)
                                    11        21        31        41        51        61        71        81        91      

Chain C from PDB  Type:PROTEIN  Length:96
 aligned with SNRPA_HUMAN | P09012 from UniProtKB/Swiss-Prot  Length:282

    Alignment length:96
                                    11        21        31        41        51        61        71        81        91      
               SCOP domains d1urnc_ C: Splicesomal U1A protein                                                               SCOP domains
               CATH domains 1urnC00 C:2-97  [code=, no name defined]                                              CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------ Pfam domains
         Sec.struct. author .........eeeee.......hhhhhhhhhhhhhhh..eeeeee.........eeeee..hhhhhhhhhhh..........eeee.....hhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE --------RRM  PDB: C:10-89 UniProt: 10-89                                                -------- PROSITE
           Transcript 1 (1) Exon 1.1  PDB: C:2-25   ---------------------------------------------------------Exon 1.3        Transcript 1 (1)
           Transcript 1 (2) -----------------------Exon 1.2  PDB: C:25-82 UniProt: 25-82                     --------------- Transcript 1 (2)
                                    11        21        31        41        51        61        71        81        91      

Chain P from PDB  Type:DNA/RNA  Length:20
                  1urn P  1 AAUCCAUUGCACUCGGAUUU 21
                                    10  ||    21

Chain Q from PDB  Type:RNA  Length:21
                  1urn Q  1 AAUCCAUUGCACUCCGGAUUU 21
                                    10        20 

Chain R from PDB  Type:DNA/RNA  Length:20
                  1urn R  1 AAUCCAUUGCACUCGGAUUU 21
                                    10  ||    21

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 3)

Asymmetric Unit

(-) CATH Domains  (1, 3)

Asymmetric Unit
Class: Alpha Beta (26913)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1URN)

(-) Gene Ontology  (16, 16)

Asymmetric Unit(hide GO term definitions)
Chain A,B,C   (SNRPA_HUMAN | P09012)
molecular function
    GO:0003723    RNA binding    Interacting selectively and non-covalently with an RNA molecule or a portion thereof.
    GO:0030619    U1 snRNA binding    Interacting selectively and non-covalently with the U1 small nuclear RNA (U1 snRNA).
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0017069    snRNA binding    Interacting selectively and non-covalently with a small nuclear RNA (snRNA).
    GO:0035614    snRNA stem-loop binding    Interacting selectively and non-covalently with a stem-loop in a small nuclear RNA (snRNA). An RNA stem-loop is a secondary RNA structure consisting of a double-stranded RNA (dsRNA) stem and a terminal loop.
biological process
    GO:0008380    RNA splicing    The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA.
    GO:0006397    mRNA processing    Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide.
    GO:0000398    mRNA splicing, via spliceosome    The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced.
cellular component
    GO:0005685    U1 snRNP    A ribonucleoprotein complex that contains small nuclear RNA U1.
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.
    GO:0005730    nucleolus    A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome.
    GO:0005654    nucleoplasm    That part of the nuclear content other than the chromosomes or the nucleolus.
    GO:0005634    nucleus    A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent.
    GO:0005681    spliceosomal complex    Any of a series of ribonucleoprotein complexes that contain snRNA(s) and small nuclear ribonucleoproteins (snRNPs), and are formed sequentially during the spliceosomal splicing of one or more substrate RNAs, and which also contain the RNA substrate(s) from the initial target RNAs of splicing, the splicing intermediate RNA(s), to the final RNA products. During cis-splicing, the initial target RNA is a single, contiguous RNA transcript, whether mRNA, snoRNA, etc., and the released products are a spliced RNA and an excised intron, generally as a lariat structure. During trans-splicing, there are two initial substrate RNAs, the spliced leader RNA and a pre-mRNA.


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    CL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    GOL  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1urn)
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]
    Biological Unit 3  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
  RNA: ribbon; protein: ribbon, secondary structure; glycerol, chlorine
  RNA: sticks; protein: ribbon
  RNA: spacefill; protein: ribbon
  RNA: spacefill; protein: ribbon
  RNA: ribbon, sticks; protein: spacefill
  RNA: ribbon, plates; protein: ribbon
  spacefill, water
  RNA: ribbon, sticks; protein: ribbon
  ribbon, monomer
  ribbon, numbering, monomer
  RNA: ribbon, sticks, numbering; protein: spacefill; monomer
Distance Plot
  representative atom CA, O3*

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  SNRPA_HUMAN | P09012
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  SNRPA_HUMAN | P09012
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        SNRPA_HUMAN | P090121aud 1drz 1dz5 1fht 1m5k 1m5o 1m5p 1m5v 1nu4 1oia 1sj3 1sj4 1sjf 1u6b 1vbx 1vby 1vbz 1vc0 1vc5 1vc6 1zzn 2a3j 2nz4 2oih 2oj3 2u1a 3bo2 3bo3 3bo4 3cul 3cun 3egz 3g8s 3g8t 3g96 3g9c 3hhn 3iin 3irw 3iwn 3k0j 3l3c 3mum 3mur 3mut 3muv 3mxh 3p49 3pgw 3r1h 3r1l 3ucu 3ucz 3ud3 3ud4 3utr 4c4w 4pr6 4prf 4w90 4w92 4yb1 5ddo 5ddp 5ddq 5ddr 5fj4

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1URN)