Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF A WILD-TYPE CRE RECOMBINASE-LOXP SYNAPSE: PHOSPHOTYROSINE COVALENT INTERMEDIATE
 
Authors :  E. Ennifar, J. E. W. Meyer, F. Buchholz, A. F. Stewart, D. Suck
Date :  01 Aug 03  (Deposition) - 16 Sep 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.91
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,X,Y
Keywords :  Cre, Recombinase, Dna, Replication/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  E. Ennifar, J. E. W. Meyer, F. Buchholz, A. F. Stewart, D. Suck
Crystal Structure Of A Wild-Type Cre Recombinase-Loxp Synapse Reveals A Novel Spacer Conformation Suggesting An Alternative Mechanism For Dna Cleavage Activation
Nucleic Acids Res. V. 31 5449 2003
PubMed-ID: 12954782  |  Reference-DOI: 10.1093/NAR/GKG732
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - LOXP DNA
    ChainsC, G
    EngineeredYES
    Other DetailsFIRST STRAND OF LOXP SITE, 5'-END
    SyntheticYES
 
Molecule 2 - LOXP DNA
    ChainsX, Y
    EngineeredYES
    Other DetailsFIRST STRAND OF LOXP SITE, 3'-END
    SyntheticYES
 
Molecule 3 - LOXP DNA
    ChainsD, H
    EngineeredYES
    Other DetailsSECOND STRAND OF LOXP SITE
    SyntheticYES
 
Molecule 4 - CRE RECOMBINASE
    ChainsA, B, E, F
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPGEM
    Expression System Taxid562
    Expression System Vector TypePLASMID
    Organism ScientificENTEROBACTERIA PHAGE P1
    Organism Taxid10678
    SynonymGST-LOXP-CRE RECOMBINASE FUSION PROTEIN

 Structural Features

(-) Chains, Units

  12345678910
Asymmetric/Biological Unit ABCDEFGHXY

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (4, 13)

Asymmetric/Biological Unit (4, 13)
No.NameCountTypeFull Name
1A3P2Mod. NucleotideADENOSINE-3'-5'-DIPHOSPHATE
2IOD2Ligand/IonIODIDE ION
3MG7Ligand/IonMAGNESIUM ION
4UMP2Mod. Nucleotide2'-DEOXYURIDINE 5'-MONOPHOSPHATE

(-) Sites  (5, 5)

Asymmetric Unit (5, 5)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREHIS A:40 , LYS A:43BINDING SITE FOR RESIDUE MG A 344
2AC2SOFTWAREHIS A:269BINDING SITE FOR RESIDUE MG A 345
3AC3SOFTWAREMET A:149 , ASP A:157 , ASN A:160 , ARG F:24BINDING SITE FOR RESIDUE MG A 347
4AC4SOFTWARESER A:330 , GLU A:331BINDING SITE FOR RESIDUE MG A 348
5AC5SOFTWAREDA D:105BINDING SITE FOR RESIDUE MG D 310

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1Q3V)

(-) Cis Peptide Bonds  (4, 4)

Asymmetric/Biological Unit
No.Residues
1Phe A:64 -Pro A:65
2Phe B:64 -Pro B:65
3Phe E:64 -Pro E:65
4Phe F:64 -Pro F:65

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1Q3V)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1Q3V)

(-) Exons   (0, 0)

(no "Exon" information available for 1Q3V)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:332
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:332
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    10 NLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1q3va1 A:10-129 Cre recombinase                                                                                        d1q3va2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains ----------1q3vA02 A:20-130  [code=1.10.150.130, no name defined]                                                         -1q3vA01 A:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ............hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhhh...........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeee.............eee.hhhhhhhhhhhhhhhh...........................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhhhh.hhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1q3v A  10 NLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    19        29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain B from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1q3vb1 B:20-129 Cre recombinase                                                                              d1q3vb2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1q3vB02 B:20-130  [code=1.10.150.130, no name defined]                                                         -1q3vB01 B:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.......hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhh......hhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhh........eeeeee....eeeeeeeee.hhhhhhhhhhhhhhhhhhhh.......................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhh..........hhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1q3v B  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain C from PDB  Type:DNA  Length:16
                                                
                 1q3v C 100 CGATAACuTCGTATAa 115
                                   109     |
                                 107-UMP 115-A3P

Chain D from PDB  Type:DNA  Length:37
                                                                     
                 1q3v D 100 GGATAACTTCGTATAGCATACATTATACGAAGTTATC 136
                                   109       119       129       

Chain E from PDB  Type:PROTEIN  Length:321
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:321
                                    30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340 
            RECR_BPP1    21 DEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1q3ve1 E:21-129 Cre recombinase                                                                             d1q3ve2 E:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1q3vE02 E:21-130  [code=1.10.150.130, no name defined]                                                        -1q3vE01 E:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhh....hhhhh.hhhhhhhhhhhhhhhh..........hhhhhhhhhhh.......hhhhhhhhhhhhhhhh.hhhhhhhhhhhhh.ee...ee.ee.............ee...hhhhhhhhhhhhhhh...........................hhhhhhhhhhhhhhhhhh..............hhhhhhhhhhhhhhh.hhhhhhhhhh...hhhhhhhh.......hhhhhhhhh Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1q3v E  21 DEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340 

Chain F from PDB  Type:PROTEIN  Length:322
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:322
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  
            RECR_BPP1    20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d1q3vf1 F:20-129 Cre recombinase                                                                              d1q3vf2 F:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains 1q3vF02 F:20-130  [code=1.10.150.130, no name defined]                                                         -1q3vF01 F:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
           Pfam domains (1) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1q3vF01 F:138-331                                                                                                                                                                 ---------- Pfam domains (1)
           Pfam domains (2) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1q3vF02 F:138-331                                                                                                                                                                 ---------- Pfam domains (2)
           Pfam domains (3) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1q3vF03 F:138-331                                                                                                                                                                 ---------- Pfam domains (3)
           Pfam domains (4) ----------------------------------------------------------------------------------------------------------------------Phage_integrase-1q3vF04 F:138-331                                                                                                                                                                 ---------- Pfam domains (4)
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.hhhhhhhhhhh.eee.....eeeeeee....eeeeeeeee.hhhhhhhhhhhhhhhh...........ee.....ee.......hhhhhhhhhhhhhhhhh...............hhhhhhhhhhhhhh..hhhhhhhhhh..hhhhhhhh..........hhhhhh. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1q3v F  20 SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    29        39        49        59        69        79        89        99       109       119       129       139       149       159       169       179       189       199       209       219       229       239       249       259       269       279       289       299       309       319       329       339  

Chain G from PDB  Type:DNA  Length:16
                                                
                 1q3v G 100 CGATAACuTCGTATAa 115
                                   109     |
                                 107-UMP 115-A3P

Chain H from PDB  Type:DNA  Length:37
                                                                     
                 1q3v H 100 GGATAACTTCGTATAGCATACATTATACGAAGTTATC 136
                                   109       119       129       

Chain X from PDB  Type:DNA  Length:21
                                                     
                 1q3v X 116 TGTATGCTATACGAAGTTATC 136
                                   125       135 

Chain Y from PDB  Type:DNA  Length:21
                                                     
                 1q3v Y 116 TGTATGCTATACGAAGTTATC 136
                                   125       135 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 8)

Asymmetric/Biological Unit

(-) CATH Domains  (2, 8)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 4)

Asymmetric/Biological Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B,E,F   (RECR_BPP1 | P06956)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Interchromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    A3P  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    IOD  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    UMP  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Phe A:64 - Pro A:65   [ RasMol ]  
    Phe B:64 - Pro B:65   [ RasMol ]  
    Phe E:64 - Pro E:65   [ RasMol ]  
    Phe F:64 - Pro F:65   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1q3v
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        RECR_BPP1 | P069561crx 1drg 1f44 1kbu 1ma7 1nzb 1ouq 1pvp 1pvq 1pvr 1q3u 1xns 1xo0 2crx 2hof 2hoi 3c28 3c29 3crx 3mgv 4crx 5crx

(-) Related Entries Specified in the PDB File

1nzb PRE-CLEAVAGE COMPLEX (LOW RESOLUTION)
1ouq COVALENT INTERMEDIATE (LOW RESOLUTION)
1q3u PRE-CLEAVAGE COMPLEX (HIGH RESOLUTION)