Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit - manually
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit - manually
Asym./Biol. Unit - manually  (Jmol Viewer)
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  K. S. Swinger, K. M. Lemberg, Y. Zhang, P. A. Rice
Date :  30 Apr 03  (Deposition) - 13 May 03  (Release) - 13 Jul 11  (Revision)
Resolution :  1.90
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Protein-Dna Complex, Dna Bending, Hu, Dna Binding Protein-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  K. S. Swinger, K. M. Lemberg, Y. Zhang, P. A. Rice
Flexible Dna Bending In Hu-Dna Cocrystal Structures
Embo J. V. 22 3749 2003
PubMed-ID: 12853489  |  Reference-DOI: 10.1093/EMBOJ/CDG351

(-) Compounds

    ChainsC, D
    ChainsA, B
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPET21A (PETAHU)
    Expression System StrainRJ1878 LACKS FUNCTIONAL HU GENES
    Expression System Taxid562
    Expression System Vector TypePLASMID
    GeneHUP OR HANA OR ASR3935
    Organism ScientificANABAENA SP.
    Organism Taxid1167

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 1P71)

(-) Sites  (0, 0)

(no "Site" information available for 1P71)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1P71)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1P71)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1P71)

(-) PROSITE Motifs  (1, 2)

Asymmetric/Biological Unit (1, 2)
1HISTONE_LIKEPS00045 Bacterial histone-like DNA-binding proteins signature.DBH_NOSS146-65

(-) Exons   (0, 0)

(no "Exon" information available for 1P71)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:94
 aligned with DBH_NOSS1 | P05514 from UniProtKB/Swiss-Prot  Length:94

    Alignment length:94
                                    10        20        30        40        50        60        70        80        90    
               SCOP domains d1p71a_ A: HU protein                                                                          SCOP domains
               CATH domains 1p71A00 A:1-94 HU Protein, subunit A                                                           CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh...eee...eeeeeeee..eeee......eeee..eeeeeeeehhhhhhhhh.... Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------HISTONE_LIKE        ----------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90    

Chain B from PDB  Type:PROTEIN  Length:93
 aligned with DBH_NOSS1 | P05514 from UniProtKB/Swiss-Prot  Length:94

    Alignment length:93
                                    10        20        30        40        50        60        70        80        90   
               SCOP domains d1p71b_ B: HU protein                                                                         SCOP domains
               CATH domains 1p71B00 B:1-93 HU Protein, subunit A                                                          CATH domains
           Pfam domains (1) Bac_DNA_binding-1p71B01 B:1-90                                                            --- Pfam domains (1)
           Pfam domains (2) Bac_DNA_binding-1p71B02 B:1-90                                                            --- Pfam domains (2)
         Sec.struct. author .hhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhhhhhhh...eee...eeeeeeee..eeee......eeee..eeeeeeeehhhhhhhhh... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------HISTONE_LIKE        ---------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90   

Chain C from PDB  Type:DNA  Length:20
                  1p71 C  1 TGCTTATCAATTTGTTGCAC 20
                                    10        20

Chain D from PDB  Type:DNA  Length:20
                  1p71 D  1 TGCTTATCAATTTGTTGCAC 20
                                    10        20

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 2)

Asymmetric/Biological Unit

(-) CATH Domains  (1, 2)

Asymmetric/Biological Unit

(-) Pfam Domains  (1, 2)

Asymmetric/Biological Unit

(-) Gene Ontology  (3, 3)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (DBH_NOSS1 | P05514)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
    GO:0030261    chromosome condensation    The progressive compaction of dispersed interphase chromatin into threadlike chromosomes prior to mitotic or meiotic nuclear division, or during apoptosis, in eukaryotic cells.
    GO:0043158    heterocyst differentiation    The process in which a relatively unspecialized cell acquires specialized features of a heterocyst, a differentiated cell in certain cyanobacteria whose purpose is to fix nitrogen.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 1p71)
(no "Sites" information available for 1p71)
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1p71)

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  DBH_NOSS1 | P05514
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  DBH_NOSS1 | P05514
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        DBH_NOSS1 | P055141p51 1p78

(-) Related Entries Specified in the PDB File