Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF TN5 TRANSPOSASE COMPLEXED WITH RESOLVED OUTSIDE END DNA
 
Authors :  H. M. Holden, J. B. Thoden, M. Steiniger-White, W. S. Reznikoff, S. Lovell, I. Rayment
Date :  24 Sep 02  (Deposition) - 27 Sep 02  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  1.90
Chains :  Asym. Unit :  A,B,C
Biol. Unit 1:  A,B,C  (2x)
Keywords :  Transposase, Hairpin, Dna Binding, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  M. Steiniger-White, I. Rayment, W. S. Reznikoff
Structure/Function Insights Into Tn5 Transposition.
Curr. Opin. Struct. Biol. V. 14 50 2004
PubMed-ID: 15102449  |  Reference-DOI: 10.1016/J.SBI.2004.01.008
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA TRANSFERRED STRAND
    ChainsB
    EngineeredYES
    Other DetailsSEQUENCE OCCURS NATURALLY IN THE TN5 TRANSPOSON
    SyntheticYES
 
Molecule 2 - DNA NON-TRANSFERRED STRAND
    ChainsC
    EngineeredYES
    Other DetailsSEQUENCE OCCURS NATURALLY IN THE TN5 TRANSPOSON
    SyntheticYES
 
Molecule 3 - TN5 TRANSPOSASE
    ChainsA
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPTYB1
    Expression System StrainBL21(DE3)PLYSS
    Expression System Taxid562
    Expression System Vector TypePLASMID
    MutationYES
    Organism ScientificESCHERICHIA COLI
    Organism Taxid562

 Structural Features

(-) Chains, Units

  123
Asymmetric Unit ABC
Biological Unit 1 (2x)ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 7)

Asymmetric Unit (3, 7)
No.NameCountTypeFull Name
1EDO3Ligand/Ion1,2-ETHANEDIOL
2MG2Ligand/IonMAGNESIUM ION
3MN2Ligand/IonMANGANESE (II) ION
Biological Unit 1 (1, 6)
No.NameCountTypeFull Name
1EDO6Ligand/Ion1,2-ETHANEDIOL
2MG-1Ligand/IonMAGNESIUM ION
3MN-1Ligand/IonMANGANESE (II) ION

(-) Sites  (7, 7)

Asymmetric Unit (7, 7)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREASP A:97 , GLU A:326 , DG B:20 , HOH B:21 , DC C:1BINDING SITE FOR RESIDUE MN A 478
2AC2SOFTWAREASP A:97 , ASP A:188 , HOH A:485 , HOH A:486 , DC C:1BINDING SITE FOR RESIDUE MN A 479
3AC3SOFTWARESER A:178 , SER A:181 , HOH A:974BINDING SITE FOR RESIDUE MG A 480
4AC4SOFTWAREGLU A:451 , GLU A:454 , HOH A:726 , HOH A:730 , HOH A:765 , HOH A:794BINDING SITE FOR RESIDUE MG A 481
5AC5SOFTWAREARG A:256 , LEU A:296 , DT C:2 , DG C:3BINDING SITE FOR RESIDUE EDO A 482
6AC6SOFTWARESER A:42 , THR A:334 , GLY A:335 , TRP A:450 , HOH A:653 , HOH A:802BINDING SITE FOR RESIDUE EDO A 483
7AC7SOFTWAREGLU A:146 , TRP A:148 , GLU A:159 , LYS A:164 , ARG A:415 , HOH A:577BINDING SITE FOR RESIDUE EDO A 484

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1MUS)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1MUS)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1MUS)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1MUS)

(-) Exons   (0, 0)

(no "Exon" information available for 1MUS)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:458
 aligned with TN5P_ECOLX | Q46731 from UniProtKB/Swiss-Prot  Length:476

    Alignment length:474
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  476 
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353       363       373       383       393       403       413       423       433       443       453       463       473  | 
           TN5P_ECOLX     4 SALHRAADWAKSVFSSAALGDPRRTARLVNVAAQLAKYSGKSITISSEGSEAMQEGAYRFIRNPNVSAEAIRKAGAMQTVKLAQEFPELLAIEDTTSLSYRHQVAEELGKLGSIQDKSRGWWVHSVLLLEATTFRTVGLLHQEWWMRPDDPADADEKESGKWLAAAATSRLRMGSMMSNVIAVCDREADIHAYLQDKLAHNERFVVRSKHPRKDVESGLYLYDHLKNQPELGGYQISIPQKGVVDKRGKRKNRPARKASLSLRSGRITLKQGNITLNAVLAEEINPPKGETPLKWLLLTSEPVESLAQALRVIDIYTHRWRIEEFHKAWKTGAGAERQRMEEPDNLERMVSILSFVAVRLLQLRESFTLPQALRAQGLLKEAEHVESQSAETVLTPDECQLLGYLDKGKRKRKEKAGSLQWAYMAIARLGGFMDSKRTGIASWGALWEGWEALQSKLDGFLAAKDLMAQGIKI-   -
               SCOP domains d1musa_ A: Transposase inhibitor (Tn5 transposase)                                                                                                                                                                                                                                                                                                                                                                                                                                         SCOP domains
               CATH domains 1musA01 A:4-69 Tn5 transposase; domain 1                          1musA02 A:70-345 Transposase Inhibitor Protein From Tn5; Chain A, domain 1                                                                                                                                                                                                          1musA03 A:346-471 Transferas                e Inhibitor Protein From Tn5; Chain                                               ------ CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------DDE_Tnp_1-1musA01 A:124-363                                                                                                                                                                                                                     ----Dimer_                Tnp_Tn5-1musA02 A:368-476                                                              - Pfam domains
         Sec.struct. author ....hhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh...hhhhhh..hhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....eeeeeeeeeeee.hhhhhhh..........eeeeeeeeeeee.....eeeeeeeeee....hhhhh..hhhhhhhhhhhhhhhhhhhhhh.eeeeehhhhhhhhhhhhhhhh..eeeee............hhhhhhhh....eeeeeee..eeee.....eeee..eeeeeeeeeeeeeehhhheeeeeeeeeee.........eeeeee.....hhhhhhhhhhhhhhhhhhhhhhhhhhh..hhhhh...hhhhhhhhhhhhhhhhhhhhhhhhhhh..----------------..hhhhh.hhhhhhhhhhhhh..........hhhhhhhhhhhhh...........hhhhhhhhhhhhhhhhhhhhhhhhhhhh..... Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Transcript
                 1mus A   4 SALHRAADWAKSVFSSAALGDPRRTARLVNVAAQLAKYSGKSITISSEGSKAAQEGAYRFIRNPNVSAEAIRKAGAMQTVKLAQEFPELLAIEDTTSLSYRHQVAEELGKLGSIQKASRGWWVHSVLLLEATTFRTVGLLHQEWWMRPDDPADADEKESGKWLAAAATSRLRMGSMMSNVIAVCDREADIHAYLQDKLAHNERFVVRSKHPRKDVESGLYLYDHLKNQPELGGYQISIPQKGVVDKRGKRKNRPARKASLSLRSGRITLKQGNITLNAVLAEEINPPKGETPLKWLLLTSEPVESLAQALRVIDIYTHRWRIEEFHKAWKTGAGAERQRMEKPDNLERMVSILSFVAVRLLQLRESFTPP----------------SQSAETVLTPDECQLLGYLDKGKRKRKEKAGSLQWAYMAIARLGGFMDSKRTGIASWGALWEGWEALQSKLDGFLAAKDLMAQGIKIG 477
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233       243       253       263       273       283       293       303       313       323       333       343       353       363       373         -      |393       403       413       423       433       443       453       463       473    
                                                                                                                                                                                                                                                                                                                                                                                                           373              390                                                                                       

Chain B from PDB  Type:DNA  Length:20
                                                    
                 1mus B   1 GACTTGTGTATAAGAGTCAG  20
                                    10        20

Chain C from PDB  Type:DNA  Length:20
                                                    
                 1mus C   1 CTGACTCTTATACACAAGTC  20
                                    10        20

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 1)

Asymmetric Unit

(-) CATH Domains  (3, 3)

Asymmetric Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (2, 2)

Asymmetric Unit
(-)
Clan: RNase_H (288)

(-) Gene Ontology  (11, 11)

Asymmetric Unit(hide GO term definitions)
Chain A   (TN5P_ECOLX | Q46731)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
    GO:0003676    nucleic acid binding    Interacting selectively and non-covalently with any nucleic acid.
    GO:0004803    transposase activity    Catalysis of the transposition of transposable elements or transposons. Transposases are involved in recombination required for transposition and are site-specific for the transposon/transposable element.
biological process
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Interchromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.
    GO:0032196    transposition    Any process involved in mediating the movement of discrete segments of DNA between nonhomologous sites.
    GO:0006313    transposition, DNA-mediated    Any process involved in a type of transpositional recombination which occurs via a DNA intermediate.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    EDO  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1mus)
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1mus
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  TN5P_ECOLX | Q46731
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  TN5P_ECOLX | Q46731
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        TN5P_ECOLX | Q467311b7e 1mm8 1muh 3ecp 4dm0

(-) Related Entries Specified in the PDB File

1mur