Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  FLPE-HOLLIDAY JUNCTION COMPLEX
 
Authors :  A. B. Conway, Y. Chen, P. A. Rice
Date :  17 Jul 02  (Deposition) - 04 Feb 03  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.80
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,I,J
Keywords :  Tyrosine Recombinase, Protein-Dna Complex, Holliday- Junction, Domain-Swapping, Ligase, Lyase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  A. B. Conway, Y. Chen, P. A. Rice
Structural Plasticity Of The Flp-Holliday Junction Complex
J. Mol. Biol. V. 326 425 2003
PubMed-ID: 12559911  |  Reference-DOI: 10.1016/S0022-2836(02)01370-0
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - SYMMETRIZED FRT SITE
    ChainsE, F
    EngineeredYES
    Other DetailsDNA 13-MER
    SyntheticYES
 
Molecule 2 - SYMMETRIZED FRT SITE
    ChainsI, J
    EngineeredYES
    Other DetailsDNA 20-MER
    SyntheticYES
 
Molecule 3 - SYMMETRIZED FRT SITE
    ChainsG, H
    EngineeredYES
    Other DetailsDNA 33-MER
    SyntheticYES
 
Molecule 4 - FLP RECOMBINASE
    ChainsA, B
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentFLPE
    GeneFLP1
    MutationYES
    Organism CommonBAKER'S YEAST
    Organism ScientificSACCHAROMYCES CEREVISIAE
    Organism Taxid4932
 
Molecule 5 - FLP RECOMBINASE
    ChainsC, D
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentFLPE
    GeneFLP1
    MutationYES
    Organism CommonBAKER'S YEAST
    Organism ScientificSACCHAROMYCES CEREVISIAE
    Organism Taxid4932
    Other DetailsMODIFIED TYR343

 Structural Features

(-) Chains, Units

  12345678910
Asymmetric/Biological Unit ABCDEFGHIJ

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric/Biological Unit (1, 2)
No.NameCountTypeFull Name
1PTR2Mod. Amino AcidO-PHOSPHOTYROSINE

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
No.NameEvidenceResiduesDescription
1CTAAUTHORARG A:191 , LYS A:223 , HIS A:305 , ARG A:308 , TRP A:330 , ARG B:191ACTIVE CATALYTIC SITE OF MONOMER A. Y343 IS DONATED BY MONOMER D.
2CTBAUTHORLYS B:223 , HIS B:305 , ARG B:308 , TRP B:330 , ARG C:191 , LYS C:223ACTIVE CATALYTIC SITE OF MONOMER B. Y343 IS DONATED BY MONOMER C.
3CTCAUTHORHIS C:305 , ARG C:308 , TRP C:330 , ARG D:191 , HIS D:305INACTIVE CATALYTIC SITE OF MONOMER C. Y343 IS DONATED BY MONOMER A IS DISORDERED.
4CTDAUTHORARG D:191 , LYS D:223 , HIS D:305 , ARG D:308 , TRP D:330INACTIVE CATALYTIC SITE OF MONOMER D. Y343 IS DONATED BY MONOMER B.

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1M6X)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1M6X)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1M6X)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1M6X)

(-) Exons   (0, 0)

(no "Exon" information available for 1M6X)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:399
 aligned with FLP_YEAST | P03870 from UniProtKB/Swiss-Prot  Length:423

    Alignment length:421
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421 
            FLP_YEAST     2 PQFGILCKTPPKVLVRQFVERFERPSGEKIALCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYYGQKHQSDITDIVSSLQLQFESSEEADKGNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYSIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTYTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
               SCOP domains d1m6xa1 A:2-129 Flp recombinase                                                                                                       d1m6xa2 A:136-422 Flp recombinase                                                                                                                                                                                                                                                               SCOP domains
               CATH domains -1m6xA01 A:3-107 FLP Recombinase,  lambda integrase-like, N-terminal domain (domain 1)                    --    ----------------      -1m6xA02 A:137-419 Intergrase catalytic core                                                                                                                                                                                                                                                --- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhh....hhhhhh.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhheee....eeeeee...hhhhhhhhhhhhh...eeeeee...----.hhhhhhhhhhhhh..------hhhhhhhhhhhhhhh..hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.hhhhhhheeeeeeeeeee...eeeeeeee........eeeee.......hhhhhhhhhhh....ee...............ee....hhhhhhhhhhhhhh.hhhhhh......hhhhhhhhhhhhhh.hhhhhhhhhh....------------.....hhhhhhhhh..eee......eee.....hhhhhhhhhhhh....hhhhhh.......hhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1m6x A   2 SQFDILCKTPPKVLVRQFVERFERPSGEKIASCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYNG----SDITDIVSSLQLQFES------GNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYPIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDK------------QITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
                                    11        21        31        41        51        61        71        81        91       101       | -  |    121       | -    |  141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331 |       -    |  351       361       371       381       391       401       411       421 
                                                                                                                                     109  114            129    136                                                                                                                                                                                                  333          346                                                                            

Chain B from PDB  Type:PROTEIN  Length:401
 aligned with FLP_YEAST | P03870 from UniProtKB/Swiss-Prot  Length:423

    Alignment length:421
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421 
            FLP_YEAST     2 PQFGILCKTPPKVLVRQFVERFERPSGEKIALCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYYGQKHQSDITDIVSSLQLQFESSEEADKGNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYSIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTYTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
               SCOP domains d1m6xb1 B:2-129 Flp recombinase                                                                                                       d1m6xb2 B:136-422 Flp recombinase                                                                                                                                                                                                                                                               SCOP domains
               CATH domains -1m6xB01 B:3-107 FLP Recombinase,  lambda integrase-like, N-terminal domain (domain 1)                    --    ----------------      -1m6xB02 B:137-419 Intergrase catalytic core                                                                                                                                                                                                                                                --- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhh....hhhhhh.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhheee....eeeeee...hhhhhhhhhhhhh...eeeeee...----.hhhhhhhhhhhhh..------...hhhhhhhhhhhh..hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.hhhhhhheeeeeeeeeee...eeeeeeee........eeeee.......hhhhhhhhhhh....ee...............ee....hhhhhhhhhhhhhh.hhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhh...----------........hhhhhhhhhh.eee......eee.....hhhhhhhhhhhh....hhhhhh.......hhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1m6x B   2 SQFDILCKTPPKVLVRQFVERFERPSGEKIASCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYNG----SDITDIVSSLQLQFES------GNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYPIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSD----------YTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
                                    11        21        31        41        51        61        71        81        91       101       | -  |    121       | -    |  141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331|        - |     351       361       371       381       391       401       411       421 
                                                                                                                                     109  114            129    136                                                                                                                                                                                                 332        343                                                                               

Chain C from PDB  Type:PROTEIN  Length:400
 aligned with FLP_YEAST | P03870 from UniProtKB/Swiss-Prot  Length:423

    Alignment length:421
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421 
            FLP_YEAST     2 PQFGILCKTPPKVLVRQFVERFERPSGEKIALCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYYGQKHQSDITDIVSSLQLQFESSEEADKGNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYSIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTYTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
               SCOP domains d1m6xc1 C:2-129 Flp recombinase                                                                                                        d1m6xc2 C:137-422 Flp recombinase                                                                                                                                                                                                                                                              SCOP domains
               CATH domains -1m6xC01 C:3-106 FLP Recombinase,  lambda integrase-like, N-terminal domain (domain 1)                   --     ----------------       1m6xC02 C:137-417 Intergrase catalytic core                                                                                                                                                                                                                                              ----- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhh....hhhhhh.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhheee....eeeeee...hhhhhhhhhhhhh...eeeeee..-----.hhhhhhhhhhhhh..-------hhhhhhhhhhhhh...hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.hhhhhhheeeeeeeeeee...eeeeeeee........eeeee.......hhhhhhhhhhh....ee.......----....ee....hhhhhhhhhhhhhh.hhhhhh......hhhhhhhhhhhhhh.hhhhhhhhhh......hhhhhhhh.......hhhhhhhhh..eeee....eeee.....hhhhhhhhhhh-----hhhhhh.......hhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1m6x C   2 SQFDILCKTPPKVLVRQFVERFERPSGEKIASCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYN-----SDITDIVSSLQLQFES-------NSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTG----NKQEYQLLKDNLVRSYNKALKKNAPYPIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTyTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQ-----EGSIRYPAWNGIISQEVLDYLSSYINRR 422
                                    11        21        31        41        51        61        71        81        91       101      |  -  |    121       | -     | 141       151       161       171       181       191       201       211       221       231       241       251       261 |    |271       281       291       301       311       321       331       341 |     351       361       371       381       | -   |   401       411       421 
                                                                                                                                    108   114            129     137                                                                                                                           263  268                                                                        343-PTR                                       389   395                           

Chain D from PDB  Type:PROTEIN  Length:400
 aligned with FLP_YEAST | P03870 from UniProtKB/Swiss-Prot  Length:423

    Alignment length:421
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421 
            FLP_YEAST     2 PQFGILCKTPPKVLVRQFVERFERPSGEKIALCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYYGQKHQSDITDIVSSLQLQFESSEEADKGNSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGNSSSNKQEYQLLKDNLVRSYNKALKKNAPYSIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTYTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQLKGSAEGSIRYPAWNGIISQEVLDYLSSYINRR 422
               SCOP domains d1m6xd1 D:2-129 Flp recombinase                                                                                                        d1m6xd2 D:137-422 Flp recombinase                                                                                                                                                                                                                                                              SCOP domains
               CATH domains -1m6xD01 D:3-106 FLP Recombinase,  lambda integrase-like, N-terminal domain (domain 1)                   --     ----------------       1m6xD02 D:137-417 Intergrase catalytic core                                                                                                                                                                                                                                              ----- CATH domains
           Pfam domains (1) ------------------------------------------Flp_N-1m6xD05 D:44-128                                                               -       Flp_C-1m6xD01 D:137-380                                                                                                                                                                                                                             ---------     ---------------------------- Pfam domains (1)
           Pfam domains (2) ------------------------------------------Flp_N-1m6xD06 D:44-128                                                               -       Flp_C-1m6xD02 D:137-380                                                                                                                                                                                                                             ---------     ---------------------------- Pfam domains (2)
           Pfam domains (3) ------------------------------------------Flp_N-1m6xD07 D:44-128                                                               -       Flp_C-1m6xD03 D:137-380                                                                                                                                                                                                                             ---------     ---------------------------- Pfam domains (3)
           Pfam domains (4) ------------------------------------------Flp_N-1m6xD08 D:44-128                                                               -       Flp_C-1m6xD04 D:137-380                                                                                                                                                                                                                             ---------     ---------------------------- Pfam domains (4)
         Sec.struct. author hhhhhhhhhhhhhhhhhhhhh....hhhhhh.hhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhheee....eeeeee...hhhhhhhhhhhhh...eeeeee..-----.hhhhhhhhhhhhh..-------hhhhhhhhhhhhh...hhhhhhhhhhhhhhh...hhhhhhhhhhhhhhhhhhh.hhhhhhh.hhhhheeeee...eeeeeeee........eeeee.......hhhhhhhhhhh....ee........----...ee....hhhhhhhhhhhhhh.hhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhh......hhhhhhhhhh.eeee....eeee.....hhhhhhhhhhh-----hhhhhh.......hhhhhhhhhhhhhh. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 1m6x D   2 SQFDILCKTPPKVLVRQFVERFERPSGEKIASCAAELTYLCWMITHNGTAIKRATFMSYNTIISNSLSFDIVNKSLQFKYKTQKATILEASLKKLIPAWEFTIIPYN-----SDITDIVSSLQLQFES-------NSHSKKMLKALLSEGESIWEITEKILNSFEYTSRFTKTKTLYQFLFLATFINCGRFSDIKNVDPKSFKLVQNKYLGVIIQCLVTETKTSVSRHIYFFSARGRIDPLVYLDEFLRNSEPVLKRVNRTGN----KQEYQLLKDNLVRSYNKALKKNAPYPIFAIKNGPKSHIGRHLMTSFLSMKGLTELTNVVGNWSDKRASAVARTTyTHQITAIPDHYFALVSRYYAYDPISKEMIALKDETNPIEEWQHIEQ-----EGSIRYPAWNGIISQEVLDYLSSYINRR 422
                                    11        21        31        41        51        61        71        81        91       101      |  -  |    121       | -     | 141       151       161       171       181       191       201       211       221       231       241       251       261  |    271       281       291       301       311       321       331       341 |     351       361       371       381       | -   |   401       411       421 
                                                                                                                                    108   114            129     137                                                                                                                            264  269                                                                       343-PTR                                       389   395                           

Chain E from PDB  Type:DNA  Length:13
                                             
                 1m6x E   1 TAAGTTCCTATTC  13
                                    10   

Chain F from PDB  Type:DNA  Length:13
                                             
                 1m6x F   1 TAAGTTCCTATTC  13
                                    10   

Chain G from PDB  Type:DNA  Length:33
                                                                 
                 1m6x G   1 TAAGTTCCTATTCTTTAAAAGAATAGGAACTTC  33
                                    10        20        30   

Chain H from PDB  Type:DNA  Length:33
                                                                 
                 1m6x H   1 TAAGTTCCTATTCTTTAAAAGAATAGGAACTTC  33
                                    10        20        30   

Chain I from PDB  Type:DNA  Length:19
                                                   
                 1m6x I  14 TTTAAAAGAATAGGAACTT  32
                                    23         

Chain J from PDB  Type:DNA  Length:20
                                                    
                 1m6x J  14 TTTAAAAGAATAGGAACTTC  33
                                    23        33

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 8)

Asymmetric/Biological Unit

(-) CATH Domains  (2, 8)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)

(-) Pfam Domains  (2, 8)

Asymmetric/Biological Unit
(-)
Clan: DNA-mend (28)

(-) Gene Ontology  (9, 9)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B,C,D   (FLP_YEAST | P03870)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0008301    DNA binding, bending    The activity of binding selectively and non-covalently to and distorting the original structure of DNA, typically a straight helix, into a bend, or increasing the bend if the original structure was intrinsically bent due to its sequence.
    GO:0003690    double-stranded DNA binding    Interacting selectively and non-covalently with double-stranded DNA.
    GO:0003697    single-stranded DNA binding    Interacting selectively and non-covalently with single-stranded DNA.
    GO:0009009    site-specific recombinase activity    Catalysis of the formation of new phosphodiester bonds between a pair of short, unique DNA target sequences.
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Interchromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.
    GO:0042150    plasmid recombination    A process of DNA recombination occurring within a plasmid or between plasmids and other plasmids or DNA molecules.
cellular component
    GO:0005575    cellular_component    A location, relative to cellular compartments and structures, occupied by a macromolecular machine when it carries out a molecular function. There are two ways in which the gene ontology describes locations of gene products: (1) relative to cellular structures (e.g., cytoplasmic side of plasma membrane) or compartments (e.g., mitochondrion), and (2) the stable macromolecular complexes of which they are parts (e.g., the ribosome).

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    PTR  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    CTA  [ RasMol ]  +environment [ RasMol ]
    CTB  [ RasMol ]  +environment [ RasMol ]
    CTC  [ RasMol ]  +environment [ RasMol ]
    CTD  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1m6x)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1m6x
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  FLP_YEAST | P03870
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  FLP_YEAST | P03870
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        FLP_YEAST | P038701flo 1p4e

(-) Related Entries Specified in the PDB File

1flo CRYSTAL STRUCTURE OF A FLP RECOMBINASE-HOLLIDAY JUNCTION COMPLEX