Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE INTEIN HOMING ENDONUCLEASE PI-SCEI BOUND TO ITS RECOGNITION SEQUENCE
 
Authors :  C. M. Moure, F. S. Gimble, F. A. Quiocho
Date :  03 Jun 02  (Deposition) - 27 Sep 02  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.50
Chains :  Asym./Biol. Unit :  A,B,C
Keywords :  Homing Endonuclease, Intein, Protein-Dna Complex, Endonuclease, Hydrolase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  C. M. Moure, F. S. Gimble, F. A. Quiocho
Crystal Structure Of The Intein Homing Endonuclease Pi-Scei Bound To Its Recognition Sequence.
Nat. Struct. Biol. V. 9 764 2002
PubMed-ID: 12219083  |  Reference-DOI: 10.1038/NSB840
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - PI-SCEI DNA RECOGNITION REGION TOP STRAND
    ChainsB
    EngineeredYES
    SyntheticYES
 
Molecule 2 - PI-SCEI DNA RECOGNITION REGION BOTTOM STRAND
    ChainsC
    EngineeredYES
    SyntheticYES
 
Molecule 3 - ENDONUCLEASE PI-SCEI
    ChainsA
    EC Number3.1.-.-
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System PlasmidPT7PI-SCEI
    Expression System StrainDL41 (DE3)
    Expression System Taxid562
    Expression System Vector TypePLASMID
    GeneVMA1
    Organism CommonBAKER'S YEAST
    Organism ScientificSACCHAROMYCES CEREVISIAE
    Organism Taxid4932
    SynonymPI-SCEI, VMA-DERIVED ENDONUCLEASE, VDE, SCE VMA INTEIN

 Structural Features

(-) Chains, Units

  123
Asymmetric/Biological Unit ABC

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 10)

Asymmetric/Biological Unit (2, 10)
No.NameCountTypeFull Name
1CA2Ligand/IonCALCIUM ION
2MSE8Mod. Amino AcidSELENOMETHIONINE

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREGLY A:217 , ASP A:218 , ASP A:326BINDING SITE FOR RESIDUE CA A 501
2AC2SOFTWAREASP A:218 , SER A:325 , ASP A:326BINDING SITE FOR RESIDUE CA A 502

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1LWS)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1LWS)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1LWS)

(-) PROSITE Motifs  (3, 3)

Asymmetric/Biological Unit (3, 3)
 PROSITEUniProtKBPDB
No.IDACDescriptionIDLocationCountLocation
1INTEIN_N_TERPS50817 Intein N-terminal splicing motif profile.VATA_YEAST284-366  1A:1-83
2INTEIN_ENDONUCLEASEPS50819 Intein DOD-type homing endonuclease domain profile.VATA_YEAST494-642  1A:211-359
3INTEIN_C_TERPS50818 Intein C-terminal splicing motif profile.VATA_YEAST713-738  1A:430-454

(-) Exons   (1, 1)

Asymmetric/Biological Unit (1, 1)
 ENSEMBLUniProtKBPDB
No.Transcript IDExonExon IDGenome LocationLengthIDLocationLengthCountLocationLength
1.1YDL185W1YDL185W.1IV:126788-1300033216VATA_YEAST1-107110711A:1-454 (gaps)454

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:427
 aligned with VATA_YEAST | P17255 from UniProtKB/Swiss-Prot  Length:1071

    Alignment length:454
                                   293       303       313       323       333       343       353       363       373       383       393       403       413       423       433       443       453       463       473       483       493       503       513       523       533       543       553       563       573       583       593       603       613       623       633       643       653       663       673       683       693       703       713       723       733    
           VATA_YEAST   284 CFAKGTNVLMADGSIECIENIEVGNKVMGKDGRPREVIKLPRGRETMYSVVQKSQHRAHKSDSSREVPELLKFTCNATHELVVRTPRSVRRLSRTIKGVEYFEVITFEMGQKKAPDGRIVELVKEVSKSYPISEGPERANELVESYRKASNKAYFEWTIEARDLSLLGSHVRKATYQTYAPILYENDHFFDYMQKSKFHLTIEGPKVLAYLLGLWIGDGLSDRATFSVDSRDTSLMERVTEYAEKLNLCAEYKDRKEPQVAKTVNLYSKVVRGNGIRNNLNTENPLWDAIVGLGFLKDGVKNIPSFLSTDNIGTRETFLAGLIDSDGYVTDEHGIKATIKTIHTSVRDGLVSLARSLGLVVSVNAEPAKVDMNGTKHKISYAIYMSGGDVLLNVLSKCAGSKKFRPAPAAAFARECRGFYFELQELKEDDYYGITLSDDSDHQFLLANQVVVHN 737
               SCOP domains d1lwsa1 A:1-180,A:416-454 VMA1-derived endonuclease (VDE) PI-Scei intein                                                                                                            d1lwsa2 A:181-298 VMA1-derived endonuclease (VDE) PI-SceI                                                             d1lwsa3 A:299-415 VMA1-derived endonuclease (VDE) PI-SceI                                                            d1lwsa1 A:1-180,A:416-454               SCOP domains
               CATH domains 1lwsA01 A:1-180,A:416-454 Endonuclease - Pi-scei; Chain A, domain 1                                                                                                                 -------------------1lwsA02 A:200-303 Homing endonucleases                                                                  1lwsA03 A:304-398 Homing endonucleases                                                         -----------------1lwsA01 A:1-180,A:416-454               CATH domains
           Pfam domains (1) Hom_end_hint-1lwsA01 A:1-454                                                                                                                                                                                                                                                                                                                                                                                                                                           Pfam domains (1)
           Pfam domains (2) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hom_end-1lwsA02 A:302-413                                                                                       ----------------------------------------- Pfam domains (2)
           Pfam domains (3) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------Hom_end-1lwsA03 A:302-413                                                                                       ----------------------------------------- Pfam domains (3)
           Pfam domains (4) ATP-synt_ab-1lwsA04 A:1-454                                                                                                                                                                                                                                                                                                                                                                                                                                            Pfam domains (4)
         Sec.struct. author ......ee.......ee.hhh....eee.....eeeeee..eeeeeeeeeee....hhhhhh.........eeeee...eeeeeee..ee.........--...eeeeeeeee.....eeeeeeee.......--hhhhhhhhhhhhh.....eeeeeee.hhhhhh.hhhhhhh.eee.........hhhhhhh.......hhhhhhhhhhhhhhhh......eeeee..hhhhhhhhhhhhhhhh...---------.eeeee...--------------...hhhhhh....ee..ee...hhhhhhhhhhhhhhhhhhhhhheeee.....eeee...hhhhhhhhhhhhhhh..eeeeeee...ee...ee...eeeeeee.hhhhhhhhh....................eee.eeeeeeeeeeee..ee......eee.....eee. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE INTEIN_N_TER  PDB: A:1-83 UniProt: 284-366                                         -------------------------------------------------------------------------------------------------------------------------------INTEIN_ENDONUCLEASE  PDB: A:211-359 UniProt: 494-642                                                                                                 ----------------------------------------------------------------------INTEIN_C_TER              PROSITE
               Transcript 1 Exon 1.1  PDB: A:1-454 (gaps) UniProt: 1-1071 [INCOMPLETE]                                                                                                                                                                                                                                                                                                                                                                                                             Transcript 1
                 1lws A   1 CFAKGTNVLmADGSIECIENIEVGNKVmGKDGRPREVIKLPRGRETmYSVVQKSQHRAHKSDSSREVPELLKFTCNATHELVVRTPRSVRRLSRTIKGV--FEVITFEmGQKKAPDGRIVELVKEVSKSYPIS--PERANELVESYRKASNKAYFEWTIEARDLSLLGSHVRKATYQTYAPILYENDHFFDYmQKSKFHLTIEGPKVLAYLLGLWIGDGLSDRATFSVDSRDTSLmERVTEYAEKLNLCA---------VAKTVNLYS--------------ENPLWDAIVGLGFLKDGVKNIPSFLSTDNIGTRETFLAGLIDSDGYVTDEHGIKATIKTIHTSVRDGLVSLARSLGLVVSVNAEPAKVDmNGTKHKISYAIYmSGGDVLLNVLSKCAGSKKFRPAPAAAFARECRGFYFELQELKEDDYYGITLSDDSDHQFLLANQVVVHN 454
                                    10        20       |30        40      | 50        60        70        80        90        |- |     110       120       130  |  | 140       150       160       170       180       190  |    200       210       220       230     | 240       250       260       | -         -  |    290       300       310       320       330       340       350       360       370 |     380    |  390       400       410       420       430       440       450    
                                    10-MSE            28-MSE             47-MSE                                              99  |      |                     133  |                                                      193-MSE                                    236-MSE       250       260     268            283                                                                                      372-MSE      385-MSE                                                                 
                                                                                                                               102      |                        136                                                                                                                                                                                                                                                                                                                              
                                                                                                                                      109-MSE                                                                                                                                                                                                                                                                                                                                                     

Chain B from PDB  Type:DNA  Length:34
                                                                  
                 1lws B   2 TCTATGTCGGGTGCGGAGAAAGAGGTAATGAAAT  35
                                    11        21        31    

Chain C from PDB  Type:DNA  Length:34
                                                                  
                 1lws C   4 ATTTCATTACCTCTTTCTCCGCACCCGACATAGA  37
                                    13        23        33    

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 3)

Asymmetric/Biological Unit

(-) CATH Domains  (2, 3)

Asymmetric/Biological Unit
(-)
Class: Alpha Beta (26913)
(-)
Class: Mainly Beta (13760)

(-) Pfam Domains  (3, 4)

Asymmetric/Biological Unit
(-)
Clan: H-int (15)

(-) Gene Ontology  (25, 25)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A   (VATA_YEAST | P17255)
molecular function
    GO:0005524    ATP binding    Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
    GO:0000166    nucleotide binding    Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose.
    GO:0005515    protein binding    Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).
    GO:0046961    proton-transporting ATPase activity, rotational mechanism    Enables the transfer of protons from one side of a membrane to the other according to the reaction: ATP + H2O + H+(in) = ADP + phosphate + H+(out), by a rotational mechanism.
biological process
    GO:0015991    ATP hydrolysis coupled proton transport    The transport of protons against an electrochemical gradient, using energy from ATP hydrolysis.
    GO:0046034    ATP metabolic process    The chemical reactions and pathways involving ATP, adenosine triphosphate, a universally important coenzyme and enzyme regulator.
    GO:0044267    cellular protein metabolic process    The chemical reactions and pathways involving a specific protein, rather than of proteins in general, occurring at the level of an individual cell. Includes cellular protein modification.
    GO:0016539    intein-mediated protein splicing    The removal of an internal amino acid sequence (an intein) from a protein during protein maturation; the excision of inteins is precise and the N- and C-terminal exteins are joined by a normal peptide bond. Protein splicing involves 4 nucleophilic displacements by the 3 conserved splice junction residues.
    GO:0006314    intron homing    Lateral transfer of an intron to a homologous allele that lacks the intron, mediated by a site-specific endonuclease encoded within the mobile intron.
    GO:0006811    ion transport    The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.
    GO:0030908    protein splicing    The post-translational removal of peptide sequences from within a protein sequence.
    GO:0006810    transport    The directed movement of substances (such as macromolecules, small molecules, ions) or cellular components (such as complexes and organelles) into, out of or within a cell, or between cells, or within a multicellular organism by means of some agent such as a transporter, pore or motor protein.
    GO:0007035    vacuolar acidification    Any process that reduces the pH of the vacuole, measured by the concentration of the hydrogen ion.
cellular component
    GO:0012505    endomembrane system    A collection of membranous structures involved in transport within the cell. The main components of the endomembrane system are endoplasmic reticulum, Golgi bodies, vesicles, cell membrane and nuclear envelope. Members of the endomembrane system pass materials through each other or though the use of vesicles.
    GO:0000329    fungal-type vacuole membrane    The lipid bilayer surrounding a vacuole, the shape of which correlates with cell cycle phase. The membrane separates its contents from the cytoplasm of the cell. An example of this structure is found in Saccharomyces cerevisiae.
    GO:0016020    membrane    A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.
    GO:0033178    proton-transporting two-sector ATPase complex, catalytic domain    A protein complex that forms part of a proton-transporting two-sector ATPase complex and catalyzes ATP hydrolysis or synthesis. The catalytic domain (F1, V1, or A1) comprises a hexameric catalytic core and a central stalk, and is peripherally associated with the membrane when the two-sector ATPase is assembled.
    GO:0005774    vacuolar membrane    The lipid bilayer surrounding the vacuole and separating its contents from the cytoplasm of the cell.
    GO:0000221    vacuolar proton-transporting V-type ATPase, V1 domain    The V1 domain of a proton-transporting V-type ATPase found in the vacuolar membrane.
    GO:0005773    vacuole    A closed structure, found only in eukaryotic cells, that is completely surrounded by unit membrane and contains liquid material. Cells contain one or several vacuoles, that may have different functions from each other. Vacuoles have a diverse array of functions. They can act as a storage organelle for nutrients or waste products, as a degradative compartment, as a cost-effective way of increasing cell size, and as a homeostatic regulator controlling both turgor pressure and pH of the cytosol.

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MSE  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1lws)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  1lws
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  VATA_YEAST | P17255
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  3.1.-.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  VATA_YEAST | P17255
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        VATA_YEAST | P172551dfa 1ef0 1gpp 1jva 1lwt 1um2 1vde 3j9t 3j9u 3j9v 5bw9 5d80 5vox 5voy 5voz

(-) Related Entries Specified in the PDB File

1lwt CRYSTAL STRUCTURE OF THE INTEIN HOMING ENDONUCLEASE PI_SCEI BOUND TO ITS SUBSTRATE DNA (CA2+ FREE)
1vde PI-SCEI, A HOMING ENDONUCLEASE WITH PROTEIN SPLICING ACTIVITY