Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Authors :  K. S. Murakami, S. Masuda, E. A. Campbell, O. Muzzin, S. A. Darst
Date :  27 Mar 02  (Deposition) - 31 May 02  (Release) - 24 Feb 09  (Revision)
Resolution :  6.50
Chains :  Asym./Biol. Unit :  A,B,C,D,E,H,T,U
Keywords :  Helix-Turn-Helix, Coiled-Coil, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  K. S. Murakami, S. Masuda, E. A. Campbell, O. Muzzin, S. A. Darst
Structural Basis Of Transcription Initiation: An Rna Polymerase Holoenzyme-Dna Complex.
Science V. 296 1285 2002
PubMed-ID: 12016307  |  Reference-DOI: 10.1126/SCIENCE.1069595
(for further references see the PDB file header)

(-) Compounds

    ChainsA, B
    EC Number2.7.7.6
    Organism ScientificTHERMUS AQUATICUS
    Organism Taxid271
    EC Number2.7.7.6
    Organism ScientificTHERMUS AQUATICUS
    Organism Taxid271
    EC Number2.7.7.6
    Organism ScientificTHERMUS AQUATICUS
    Organism Taxid271
    EC Number2.7.7.6
    Organism ScientificTHERMUS AQUATICUS
    Organism Taxid271
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System StrainBL21 (DE3)
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    Organism ScientificTHERMUS AQUATICUS
    Organism Taxid271

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCDEHTU

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (2, 3)

Asymmetric/Biological Unit (2, 3)
No.NameCountTypeFull Name
2ZN2Ligand/IonZINC ION

(-) Sites  (1, 1)

Asymmetric Unit (1, 1)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1L9Z)

(-) Cis Peptide Bonds  (3, 3)

Asymmetric/Biological Unit
1Pro C:16 -Pro C:17
2Asn D:593 -Pro D:594
3Ala D:705 -Pro D:706

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1L9Z)

(-) PROSITE Motifs  (2, 2)

Asymmetric/Biological Unit (2, 2)
1SIGMA70_2PS00716 Sigma-70 factors family signature 2.SIGA_THEAQ397-423  1H:397-423
2RNA_POL_BETAPS01166 RNA polymerases beta chain signature.RPOB_THEAQ836-848  1C:836-848

(-) Exons   (0, 0)

(no "Exon" information available for 1L9Z)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:224
 aligned with RPOA_THEAQ | Q9KWU8 from UniProtKB/Swiss-Prot  Length:314

    Alignment length:224
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225    
               SCOP domains d1l9za_ A: DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits                                                                                                                                             SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ................................................................................................................................................................................................................................ Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225    

Chain B from PDB  Type:PROTEIN  Length:220
 aligned with RPOA_THEAQ | Q9KWU8 from UniProtKB/Swiss-Prot  Length:314

    Alignment length:220
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225
               SCOP domains d1l9zb_ B: DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits                                                                                                                                         SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ............................................................................................................................................................................................................................ Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       155       165       175       185       195       205       215       225

Chain C from PDB  Type:PROTEIN  Length:1084
 aligned with RPOB_THEAQ | Q9KWU7 from UniProtKB/Swiss-Prot  Length:1119

    Alignment length:1115
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231       241       251       261       271       281       291       301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621       631       641       651       661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111     
               SCOP domains d1l9zc_ C: DNA-directed RNA polymerase alpha(2), beta,       beta-prime and omega subunits                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .......................................................------......................................................................................................................................................-------..........................--------......................................------....................................................................................................................................................................................................................................................................................................................................-...........................---................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------RNA_POL_BETA ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51    |    - |      71        81        91       101       111       121       131       141       151       161       171       181       191       201       211|      221       231       241   |     -  |    261       271       281       291      |301       311       321       331       341       351       361       371       381       391       401       411       421       431       441       451       461       471       481       491       501       511       521       531       541       551       561       571       581       591       601       611       621 |     631       641       | - |     661       671       681       691       701       711       721       731       741       751       761       771       781       791       801       811       821       831       841       851       861       871       881       891       901       911       921       931       941       951       961       971       981       991      1001      1011      1021      1031      1041      1051      1061      1071      1081      1091      1101      1111     
                                                                                 56     63                                                                                                                                                  212     220                      245      254                                  291    298                                                                                                                                                                                                                                                                                                                                621 |                       649 653                                                                                                                                                                                                                                                                                                                                                                                                                                                                               

Chain D from PDB  Type:PROTEIN  Length:1183
 aligned with RPOC_THEAQ | Q9KWU6 from UniProtKB/Swiss-Prot  Length:1524

    Alignment length:1497
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       142       152       162       172       182       192       202       212       222       232       242       252       262       272       282       292       302       312       322       332       342       352       362       372       382       392       402       412       422       432       442       452       462       472       482       492       502       512       522       532       542       552       562       572       582       592       602       612       622       632       642       652       662       672       682       692       702       712       722       732       742       752       762       772       782       792       802       812       822       832       842       852       862       872       882       892       902       912       922       932       942       952       962       972       982       992      1002      1012      1022      1032      1042      1052      1062      1072      1082      1092      1102      1112      1122      1132      1142      1152      1162      1172      1182      1192      1202      1212      1222      1232      1242      1252      1262      1272      1282      1292      1302      1312      1322      1332      1342      1352      1362      1372      1382      1392      1402      1412      1422      1432      1442      1452      1462      1472      1482      1492       
               SCOP domains d1l9zd_ D: DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      SCOP domains
               CATH domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...........................................................................................................................................................-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................----------------.........................................................................................................................................................---....................................................................................... Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       142       152    |    -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -         -|      462       472       482       492       502       512       522       532       542       552       562       572       582       592       602       612       622       632       642       652       662       672       682       692       702       712       722       732       742       752       762       772       782       792       802       812       822       832       842       852       862       872       882       892       902       912       922       932       942       952       962       972       982       992      1002      1012      1022      1032      1042      1052      1062      1072      1082      1092      1102      1112      1122      1132      1142      1152      1162      1172      1182      1192      1202      1212      1222      1232       | -         -    | 1262      1272      1282      1292      1302      1312      1322      1332      1342      1352      1362      1372      1382      1392      1402      |  -|     1422      1432      1442      1452      1462      1472      1482      1492       
                                                                                                                                                                                    157                                                                                                                                                                                                                                                                                                     453                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               1240             1257                                                                                                                                                    1409   |                                                                                      

Chain E from PDB  Type:PROTEIN  Length:92
 aligned with RPOZ_THEAQ | Q9EVV4 from UniProtKB/Swiss-Prot  Length:99

    Alignment length:92
                                    11        21        31        41        51        61        71        81        91  
               SCOP domains d1l9ze_ E: DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits         SCOP domains
               CATH domains -------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ............................................................................................ Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91  

Chain H from PDB  Type:PROTEIN  Length:319
 aligned with SIGA_THEAQ | Q9EZJ8 from UniProtKB/Swiss-Prot  Length:438

    Alignment length:346
                                   102       112       122       132       142       152       162       172       182       192       202       212       222       232       242       252       262       272       282       292       302       312       322       332       342       352       362       372       382       392       402       412       422       432      
               SCOP domains d1l9zh_ H: DNA-directed RNA polymerase alpha(2), beta, beta-pr                  ime and omega subunits                                                                                                                                                                                                                                                     SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ..............................................................------------------....................................................................................................................................................................---------............................................................................................. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SIGMA70_2  PDB: H:397-423  --------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                   102       112       122       132       142       152 |       -         -|      182       192       202       212       222       232       242       252       262       272       282       292       302       312       322       332   |     -   |   352       362       372       382       392       402       412       422       432      
                                                                                       154                173                                                                                                                                                                336       346                                                                                            

Chain T from PDB  Type:DNA  Length:30
                1l9z T  171 AGCACAATTTAACACTTTTGTCAAGCGGCC  200
                                   180       190       200

Chain U from PDB  Type:DNA  Length:35
                                    10        20        30     

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 6)

Asymmetric/Biological Unit

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 1L9Z)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1L9Z)

(-) Gene Ontology  (14, 31)

Asymmetric/Biological Unit(hide GO term definitions)
Chain A,B   (RPOA_THEAQ | Q9KWU8)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003899    DNA-directed 5'-3' RNA polymerase activity    Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0046983    protein dimerization activity    The formation of a protein dimer, a macromolecular structure consists of two noncovalently associated identical or nonidentical subunits.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.

Chain C   (RPOB_THEAQ | Q9KWU7)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003899    DNA-directed 5'-3' RNA polymerase activity    Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0032549    ribonucleoside binding    Interacting selectively and non-covalently with a ribonucleoside, a compound consisting of a purine or pyrimidine nitrogenous base linked to ribose.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.

Chain D   (RPOC_THEAQ | Q9KWU6)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003899    DNA-directed 5'-3' RNA polymerase activity    Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.

Chain E   (RPOZ_THEAQ | Q9EVV4)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003899    DNA-directed 5'-3' RNA polymerase activity    Catalysis of the reaction: nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). Utilizes a DNA template, i.e. the catalysis of DNA-template-directed extension of the 3'-end of an RNA strand by one nucleotide at a time. Can initiate a chain 'de novo'.
    GO:0016779    nucleotidyltransferase activity    Catalysis of the transfer of a nucleotidyl group to a reactant.
    GO:0016740    transferase activity    Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2.
biological process
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.

Chain H   (SIGA_THEAQ | Q9EZJ8)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
    GO:0003700    DNA-binding transcription factor activity    A protein or a member of a complex that interacts selectively and non-covalently with a specific DNA sequence (sometimes referred to as a motif) within the regulatory region of a gene to modulate transcription. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons.
    GO:0016987    sigma factor activity    Sigma factors act as the promoter specificity subunit of eubacterial and plant plastid multisubunit RNA polymerases, whose core subunit composition is often described as alpha(2)-beta-beta-prime. Although sigma does not bind DNA on its own, when combined with the core to form the holoenzyme, the sigma factor binds specifically to promoter elements. The sigma subunit is released once elongation begins.
biological process
    GO:0006352    DNA-templated transcription, initiation    Any process involved in the assembly of the RNA polymerase preinitiation complex (PIC) at the core promoter region of a DNA template, resulting in the subsequent synthesis of RNA from that promoter. The initiation phase includes PIC assembly and the formation of the first few bonds in the RNA chain, including abortive initiation, which occurs when the first few nucleotides are repeatedly synthesized and then released. The initiation phase ends just before and does not include promoter clearance, or release, which is the transition between the initiation and elongation phases of transcription.
    GO:0010468    regulation of gene expression    Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form.
    GO:0006355    regulation of transcription, DNA-templated    Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.
    GO:0001123    transcription initiation from bacterial-type RNA polymerase promoter    Any process involved in the assembly of bacterial-type RNA polymerase preinitiation complex (PIC) at the core promoter region of a DNA template, resulting in the subsequent synthesis of RNA from that promoter. The initiation phase includes PIC assembly and the formation of the first few bonds in the RNA chain, including abortive initiation, which occurs when the first few nucleotides are repeatedly synthesized and then released. The initiation phase ends just before and does not include promoter clearance, or release, which is the transition between the initiation and elongation phases of transcription.
    GO:0006351    transcription, DNA-templated    The cellular synthesis of RNA on a template of DNA.
cellular component
    GO:0005737    cytoplasm    All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures.


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
    Ala D:705 - Pro D:706   [ RasMol ]  
    Asn D:593 - Pro D:594   [ RasMol ]  
    Pro C:16 - Pro C:17   [ RasMol ]  

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        RPOA_THEAQ | Q9KWU81hqm 1i6v 1l9u 1ynj 1ynn 2gho 4xln 4xlp 4xlq 4xlr 4xls 5tjg
        RPOB_THEAQ | Q9KWU71hqm 1i6v 1l9u 1ynj 1ynn 2gho 3mlq 4xax 4xln 4xlp 4xlq 4xlr 4xls 5tjg
        RPOC_THEAQ | Q9KWU61hqm 1i6v 1l9u 1ynj 1ynn 2auj 2gho 4xln 4xlp 4xlq 4xlr 4xls 5tjg
        RPOZ_THEAQ | Q9EVV41hqm 1i6v 1l9u 1ynj 1ynn 4xln 4xlp 4xlq 4xlr 4xls 5tjg
        SIGA_THEAQ | Q9EZJ81ku2 1ku3 1ku7 1l9u 1rio 3les 3lev 3n97 3ugo 3ugp 4ki2 4xln 4xlp 4xlq 4xlr 4xls 5tjg

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1L9Z)