Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)

(-) Description

Title :  CRE RECOMBINASE/DNA COMPLEX INTERMEDIATE I
 
Authors :  D. N. Gopaul, F. Guo, G. D. Vanduyne
Date :  19 Jun 98  (Deposition) - 14 Dec 99  (Release) - 24 Feb 09  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  2.50
Chains :  Asym. Unit :  A,B,C,D,E,F
Biol. Unit 1:  A,B,C,D,E,F  (2x)
Keywords :  Cre Recombinase, Holliday Junction, Recombination, Recombinase/Dna Complex, Hydrolase, Ligase/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  D. N. Gopaul, F. Guo, G. D. Van Duyne
Structure Of The Holliday Junction Intermediate In Cre-Loxp Site-Specific Recombination.
Embo J. V. 17 4175 1998
PubMed-ID: 9670032  |  Reference-DOI: 10.1093/EMBOJ/17.14.4175
(for further references see the PDB file header)

(-) Compounds

Molecule 1 - DNA 35-MER
    ChainsC
    EngineeredYES
    SyntheticYES
 
Molecule 2 - DNA 35-MER
    ChainsD
    EngineeredYES
    SyntheticYES
 
Molecule 3 - DNA 35-MER
    ChainsE
    EngineeredYES
    SyntheticYES
 
Molecule 4 - DNA 35-MER
    ChainsF
    EngineeredYES
    SyntheticYES
 
Molecule 5 - CRE RECOMBINASE
    Atcc25404-B1
    ChainsA, B
    Collection25404-B1
    EngineeredYES
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPET21A
    Expression System StrainBL21 (DE3)
    Expression System Taxid469008
    MutationYES
    Organism ScientificENTEROBACTERIA PHAGE P1
    Organism Taxid10678
    SynonymCRE-HJ1, RGBPP1 RECOMBINASE

 Structural Features

(-) Chains, Units

  123456
Asymmetric Unit ABCDEF
Biological Unit 1 (2x)ABCDEF

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (0, 0)

(no "Ligand,Modified Residues,Ions" information available for 3CRX)

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1CIBUNKNOWNLYS B:173 , HIS B:289 , ARG B:292 , TRP B:315 , TYR B:324RECOMBINASE ACTIVE SITE.
2CICUNKNOWNLYS A:173 , HIS A:289 , ARG A:292 , TRP A:315 , TYR A:324RECOMBINASE ACTIVE SITE.

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 3CRX)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric Unit
No.Residues
1Phe A:64 -Pro A:65
2Phe B:64 -Pro B:65

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 3CRX)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 3CRX)

(-) Exons   (0, 0)

(no "Exon" information available for 3CRX)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:323
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:323
                                    28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338   
            RECR_BPP1    19 TSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3crxa1 A:19-129 Cre recombinase                                                                               d3crxa2 A:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains -3crxA02 A:20-130  [code=1.10.150.130, no name defined]                                                         -3crxA01 A:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhh.hhh..hhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhh....hhh.hhhhhhhhhhhhhhhh............hhhhhhhhhh......hhhhhhhhhhhhhhhh...hhhhhh.....eee.....eee...................hhhhhhhhhhhhhh.hhh.........................hhhhhhhhhhhhhhhh................hhhhhhhhhhhh....hhhhhhh.....hhhhhhh.........hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3crx A  19 TSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338   

Chain B from PDB  Type:PROTEIN  Length:323
 aligned with RECR_BPP1 | P06956 from UniProtKB/Swiss-Prot  Length:343

    Alignment length:323
                                    28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338   
            RECR_BPP1    19 TSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
               SCOP domains d3crxb1 B:19-129 Cre recombinase                                                                               d3crxb2 B:130-341 Cre recombinase                                                                                                                                                                                    SCOP domains
               CATH domains -3crxB02 B:20-130  [code=1.10.150.130, no name defined]                                                         -3crxB01 B:132-331 Intergrase catalytic core                                                                                                                                                             ---------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhhhhhhh.hhh..hhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhh...hhhhhhhhhhhhhhhh......hhh.hhhhhhhhhhhhhhhh............hhhhhhhhhhh.....hhhhhhhhhhhhhhhh...hhhh....hhheee.....eeee.............eee..hhhhhhhhhhhhhh.hhh.........................hhhhhhhhhhhhhhhh................hhhhhhhhhhhhh...hhhhhhhh.....hhhhhhh........hhhhhh.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 3crx B  19 TSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLKIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED 341
                                    28        38        48        58        68        78        88        98       108       118       128       138       148       158       168       178       188       198       208       218       228       238       248       258       268       278       288       298       308       318       328       338   

Chain C from PDB  Type:DNA  Length:35
                                                                   
                 3crx C   1 TATAAGTTCGTATAGCATACATTATACGAATTTAT  35
                                    10        20        30     

Chain D from PDB  Type:DNA  Length:34
                                                                  
                 3crx D   2 ATAATTTCGTATATACAATGCTATACGAACTTAT  35
                                    11        21        31    

Chain E from PDB  Type:DNA  Length:35
                                                                   
                 3crx E   1 TATAACTTCGTATACGTATGTATATACGAAATTAT  35
                                    10        20        30     

Chain F from PDB  Type:DNA  Length:34
                                                                  
                 3crx F   2 ATAAATTCGTATAATGTTACGTATACGAAGTTAT  35
                                    11        21        31    

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (2, 4)

Asymmetric Unit

(-) CATH Domains  (2, 4)

Asymmetric Unit

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 3CRX)

(-) Gene Ontology  (3, 3)

Asymmetric Unit(hide GO term definitions)
Chain A,B   (RECR_BPP1 | P06956)
molecular function
    GO:0003677    DNA binding    Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).
biological process
    GO:0015074    DNA integration    The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome.
    GO:0006310    DNA recombination    Any process in which a new genotype is formed by reassortment of genes resulting in gene combinations different from those that were present in the parents. In eukaryotes genetic recombination can occur by chromosome assortment, intrachromosomal recombination, or nonreciprocal interchromosomal recombination. Interchromosomal recombination occurs by crossing over. In bacteria it may occur by genetic transformation, conjugation, transduction, or F-duction.

 Visualization

(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
(no "Ligands, Modified Residues, Ions" information available for 3crx)
 
  Sites
    CIB  [ RasMol ]  +environment [ RasMol ]
    CIC  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Phe A:64 - Pro A:65   [ RasMol ]  
    Phe B:64 - Pro B:65   [ RasMol ]  
 
Biological Unit
  Complete Structure
    Biological Unit 1  [ Jena3D ]

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  3crx
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  RECR_BPP1 | P06956
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        RECR_BPP1 | P069561crx 1drg 1f44 1kbu 1ma7 1nzb 1ouq 1pvp 1pvq 1pvr 1q3u 1q3v 1xns 1xo0 2crx 2hof 2hoi 3c28 3c29 3mgv 4crx 5crx

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 3CRX)