Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Biol.Unit 1 - manually
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
collapse expand < >
Image Biol.Unit 1 - manually
Biol.Unit 1 - manually  (Jmol Viewer)
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)

(-) Description

Authors :  M. S. Jurica, R. J. Monnat Junior, B. L. Stoddard
Date :  13 Aug 98  (Deposition) - 06 Jan 99  (Release) - 24 Feb 09  (Revision)
Resolution :  3.00
Chains :  Asym. Unit :  A,B,C,D,1,2,3,4
Biol. Unit 1:  A,B,1,2  (1x)
Biol. Unit 2:  C,D,3,4  (1x)
Keywords :  Endonuclease, Group I Mobile Intron, Intron Homing, Chloroplast Dna, Laglidadg Motif, Dna Complex, Transcription/Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  M. S. Jurica, R. J. Monnat Jr. , B. L. Stoddard
Dna Recognition And Cleavage By The Laglidadg Homing Endonuclease I-Crei.
Mol. Cell V. 2 469 1998
PubMed-ID: 9809068  |  Reference-DOI: 10.1016/S1097-2765(00)80146-X
(for further references see the PDB file header)

(-) Compounds

    Chains1, 3
    Other Details24 BASE PAIR DUPLEX DNA
    SynonymHOMING SITE
    Chains2, 4
    Other Details24 BASE PAIR DUPLEX DNA
    SynonymHOMING SITE
Molecule 3 - PROTEIN (I-CREI)
    ChainsA, B, C, D
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism Taxid3055

 Structural Features

(-) Chains, Units

Asymmetric Unit ABCD1234
Biological Unit 1 (1x)AB  12  
Biological Unit 2 (1x)  CD  34

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 4)

Asymmetric Unit (1, 4)
No.NameCountTypeFull Name
Biological Unit 1 (0, 0)
No.NameCountTypeFull Name
Biological Unit 2 (0, 0)
No.NameCountTypeFull Name

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
1AC1SOFTWAREDA 1:14 , HOH 1:203 , DG 2:15 , ASP A:20 , GLY B:19 , HOH B:155BINDING SITE FOR RESIDUE CA A 201

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 1BP7)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 1BP7)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 1BP7)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 1BP7)

(-) Exons   (0, 0)

(no "Exon" information available for 1BP7)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain 1 from PDB  Type:DNA  Length:24
                 1bp7 1   1 GCAAAACGTCGTGAGACAGTTTCG  24
                                    10        20    

Chain 2 from PDB  Type:DNA  Length:24
                 1bp7 2   1 CGAAACTGTCTCACGACGTTTTGC  24
                                    10        20    

Chain 3 from PDB  Type:DNA  Length:24
                 1bp7 3   1 GCAAAACGTCGTGAGACAGTTTCG  24
                                    10        20    

Chain 4 from PDB  Type:DNA  Length:24
                 1bp7 4   1 CGAAACTGTCTCACGACGTTTTGC  24
                                    10        20    

Chain A from PDB  Type:PROTEIN  Length:152
 aligned with DNE1_CHLRE | P05725 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:152
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  
               SCOP domains d1bp7a_ A: DNA endonuclease I-CreI                                                                                                                       SCOP domains
               CATH domains 1bp7A00 A:2-153 Homing endonucleases                                                                                                                     CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhhheeeeeeeee.......eeeeeeeeeeeehhhhhhhhhhhhhh...eeeee..eeeeee..hhhhhhhhhhhhhh....hhhhhhhhhhhhh.hhh...hhhhhhhhhhhhhhhhh.................. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  

Chain B from PDB  Type:PROTEIN  Length:152
 aligned with DNE1_CHLRE | P05725 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:152
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  
               SCOP domains d1bp7b_ B: DNA endonuclease I-CreI                                                                                                                       SCOP domains
               CATH domains 1bp7B00 B:2-153 Homing endonucleases                                                                                                                     CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhhheeeeeeeee.......eeeeeeeeeeeehhhhhhhhhhhhhh...eeeee..eeeeee..hhhhhhhhhhhhhh....hhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhh.........hhhh..... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  

Chain C from PDB  Type:PROTEIN  Length:152
 aligned with DNE1_CHLRE | P05725 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:152
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  
               SCOP domains d1bp7c_ C: DNA endonuclease I-CreI                                                                                                                       SCOP domains
               CATH domains 1bp7C00 C:2-153 Homing endonucleases                                                                                                                     CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhh.eeeeeeeee.......eeeeeeeeeeeehhhhhhhhhhhhhh...eeeee..eeeeee..hhhhhhhhhhhhhh....hhhhhhhhhhhhh.......hhhhhhhhhhhhhhhhh.........hhhh..... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  

Chain D from PDB  Type:PROTEIN  Length:152
 aligned with DNE1_CHLRE | P05725 from UniProtKB/Swiss-Prot  Length:163

    Alignment length:152
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  
               SCOP domains d1bp7d_ D: DNA endonuclease I-CreI                                                                                                                       SCOP domains
               CATH domains 1bp7D00 D:2-153 Homing endonucleases                                                                                                                     CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhhhhhhhhhhheeeeeeeee.......eeeeeeeeeeeehhhhhhhhhhhhhh...eeeee..eeeee...hhhhhhhhhhhhhh....hhhhhhhhhhhhh.hhh...hhhhhhhhhhhhhhhhh.................. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151  

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (1, 4)

Asymmetric Unit

(-) CATH Domains  (1, 4)

Asymmetric Unit
Class: Alpha Beta (26913)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 1BP7)

(-) Gene Ontology  (8, 8)

Asymmetric Unit(hide GO term definitions)
Chain A,B,C,D   (DNE1_CHLRE | P05725)
molecular function
    GO:0004519    endonuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids by creating internal breaks.
    GO:0016787    hydrolase activity    Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3.
    GO:0046872    metal ion binding    Interacting selectively and non-covalently with any metal ion.
    GO:0004518    nuclease activity    Catalysis of the hydrolysis of ester linkages within nucleic acids.
biological process
    GO:0006314    intron homing    Lateral transfer of an intron to a homologous allele that lacks the intron, mediated by a site-specific endonuclease encoded within the mobile intron.
    GO:0090305    nucleic acid phosphodiester bond hydrolysis    The nucleic acid metabolic process in which the phosphodiester bonds between nucleotides are cleaved by hydrolysis.
cellular component
    GO:0009507    chloroplast    A chlorophyll-containing plastid with thylakoids organized into grana and frets, or stroma thylakoids, and embedded in a stroma.
    GO:0009536    plastid    Any member of a family of organelles found in the cytoplasm of plants and some protists, which are membrane-bounded and contain DNA. Plant plastids develop from a common type, the proplastid.


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    CA  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 1bp7)
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  DNE1_CHLRE | P05725
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  DNE1_CHLRE | P05725
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        DNE1_CHLRE | P057251af5 1g9y 1g9z 1mow 1n3e 1n3f 1t9i 1t9j 1u0c 1u0d 2i3p 2i3q 2o7m 2vbj 2vbl 2vbn 2vbo 4aab 4aad 4aae 4aaf 4aag 4aqu 4aqx

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 1BP7)