Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asymmetric Unit
(-)Asym. Unit - sites
(-)Biological Unit 1
(-)Biol. Unit 1 - sites
(-)Biological Unit 2
(-)Biological Unit 3
collapse expand < >
Image Asymmetric Unit
Asymmetric Unit  (Jmol Viewer)
Image Asym. Unit - sites
Asym. Unit - sites  (Jmol Viewer)
Image Biological Unit 1
Biological Unit 1  (Jmol Viewer)
Image Biol. Unit 1 - sites
Biol. Unit 1 - sites  (Jmol Viewer)
Image Biological Unit 2
Biological Unit 2  (Jmol Viewer)
Image Biological Unit 3
Biological Unit 3  (Jmol Viewer)

(-) Description

Authors :  Y. Wang, H. Feng, Y. L. Zhu, P. Gao
Date :  21 Feb 17  (Deposition) - 12 Apr 17  (Release) - 12 Apr 17  (Revision)
Resolution :  2.99
Chains :  Asym. Unit :  A,B,C,D,E,F,G,H,M,N,O,P
Biol. Unit 1:  M,N,O,P  (1x)
Biol. Unit 2:  A,B,C,D  (1x)
Biol. Unit 3:  E,F,G,H  (1x)
Keywords :  Dna Complex, Dna Binding Protein-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  Y. Wang, H. Feng, Y. Zhu, P. Gao
Structural Insights Into Glutathione-Mediated Activation Of The Master Regulator Prfa In Listeria Monocytogenes
Protein Cell V. 8 308 2017
PubMed-ID: 28271443  |  Reference-DOI: 10.1007/S13238-017-0390-X

(-) Compounds

    ChainsM, N, A, B, E, F
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    GenePRFA, AJL40_05990, AJN46_04535, M643_11230
    Organism Taxid1639
Molecule 2 - DNA (29-MER)
    ChainsO, C, G
    Organism Taxid1639
Molecule 3 - DNA (28-MER)
    ChainsP, D, H
    Organism Taxid1639

 Structural Features

(-) Chains, Units

Asymmetric Unit ABCDEFGHMNOP
Biological Unit 1 (1x)        MNOP
Biological Unit 2 (1x)ABCD        
Biological Unit 3 (1x)    EFGH    

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 6)

Asymmetric Unit (1, 6)
No.NameCountTypeFull Name
Biological Unit 1 (1, 2)
No.NameCountTypeFull Name
Biological Unit 2 (1, 2)
No.NameCountTypeFull Name
Biological Unit 3 (1, 2)
No.NameCountTypeFull Name

(-) Sites  (6, 6)

Asymmetric Unit (6, 6)
1AC1SOFTWAREGLN M:61 , TYR M:62 , LYS M:64 , ALA M:66 , PHE M:67 , LYS M:122 , TYR M:126 , GLN M:146 , ILE M:149 , CYS M:229binding site for residue GSH M 301
2AC2SOFTWAREGLN N:61 , TYR N:62 , LYS N:64 , ALA N:66 , PHE N:67 , LYS N:122 , GLN N:123 , TYR N:126 , ILE N:149 , CYS N:229binding site for residue GSH N 301
3AC3SOFTWAREGLN A:61 , TYR A:62 , TYR A:63 , LYS A:64 , ALA A:66 , PHE A:67 , LYS A:122 , TYR A:126 , ILE A:149 , CYS A:229binding site for residue GSH A 301
4AC4SOFTWAREGLN B:61 , TYR B:62 , TYR B:63 , LYS B:64 , ALA B:66 , PHE B:67 , LYS B:122 , GLN B:123 , TYR B:126 , ILE B:149 , TYR B:154 , CYS B:229binding site for residue GSH B 301
5AC5SOFTWAREGLN E:61 , TYR E:62 , TYR E:63 , LYS E:64 , ALA E:66 , PHE E:67 , LYS E:122 , TYR E:126 , GLN E:146 , ILE E:149binding site for residue GSH E 301
6AC6SOFTWAREGLN F:61 , TYR F:62 , LYS F:64 , ALA F:66 , PHE F:67 , LYS F:122 , GLN F:123 , TYR F:126 , ILE F:149 , TYR F:154 , CYS F:229 , THR F:232binding site for residue GSH F 301

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5X6E)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric Unit
1Asn M:2 -Ala M:3
2Asp M:167 -Asn M:168

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5X6E)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5X6E)

(-) Exons   (0, 0)

(no "Exon" information available for 5X6E)

(-) Sequences/Alignments

Asymmetric Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain B from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain C from PDB  Type:DNA  Length:29
                 5x6e C   1 CATCGTCGTTAACAAATGTTAATGCCTAC  29
                                    10        20         

Chain D from PDB  Type:DNA  Length:29
                 5x6e D   1 GGTAGGCATTAACATTTGTTAACGACGAT  29
                                    10        20         

Chain E from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...hhhhhh.........eeee.............eeeeeee.eeeeee.......eeeeeee..eeee.............eeee...eeeeeeeehhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhhhh.hhhhhhhhhhhhhhhhheeee..eeee.....hhhhhhhhh...hhhhhhhhhhhhh....eee....eee..hhhhhhhh....hhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain F from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhh...eee...............eeeeeeeeeeeeeee.....eeeeeeee..eeee.............eeeeeeeeeeeeeeehhhhh........hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh...............hhhhhhhhh...hhhhhhhhh........eeee..eeee..hhhhhhhhhhhhhhhhhh......... Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain G from PDB  Type:DNA  Length:28
                 5x6e G   2 ATCGTCGTTAACAAATGTTAATGCCTAC  29
                                    11        21        

Chain H from PDB  Type:DNA  Length:29
                 5x6e H   1 GGTAGGCATTAACATTTGTTAACGACGAT  29
                                    10        20         

Chain M from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain N from PDB  Type:PROTEIN  Length:236
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231      

Chain O from PDB  Type:DNA  Length:29
                 5x6e O   1 CATCGTCGTTAACAAATGTTAATGCCTAC  29
                                    10        20         

Chain P from PDB  Type:DNA  Length:28
                 5x6e P   2 GTAGGCATTAACATTTGTTAACGACGAT  29
                                    11        21        

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5X6E)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5X6E)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5X6E)

(-) Gene Ontology  (6, 6)

Asymmetric Unit(hide GO term definitions)


(-) Interactive Views

Asymmetric Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    GSH  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
    Asn M:2 - Ala M:3   [ RasMol ]  
    Asp M:167 - Asn M:168   [ RasMol ]  
Biological Units
  Complete Structure
    Biological Unit 1  [ Jena3D ]
    Biological Unit 2  [ Jena3D ]
    Biological Unit 3  [ Jena3D ]

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        Q4TVQ0_LISMN | Q4TVQ05lrr 5lrs 5x6d

(-) Related Entries Specified in the PDB File
