Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Authors :  W. Lin, K. Das, Y. Feng, R. H. Ebright
Date :  11 Jan 17  (Deposition) - 12 Apr 17  (Release) - 03 May 17  (Revision)
Resolution :  4.04
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H
Keywords :  Rna Polymerase Complex, Transcription, Dna, Rna, Transcription-Dna- Rna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  W. Lin, S. Mandal, D. Degen, Y. Liu, Y. W. Ebright, S. Li, Y. Feng, Y. Zhang, S. Mandal, Y. Jiang, S. Liu, M. Gigliotti, M. Talaue, N. Connell, K. Das, E. Arnold, R. H. Ebright
Structural Basis Of Mycobacterium Tuberculosis Transcriptio And Transcription Inhibition.
Mol. Cell V. 66 169 2017
PubMed-ID: 28392175  |  Reference-DOI: 10.1016/J.MOLCEL.2017.03.001

(-) Compounds

    ChainsA, B
    EC Number2.7.7.6
    Expression System Taxid866768
    GeneRPOA, RV3457C, MTCY13E12.10C
    Organism Taxid83332
    StrainATCC 25618 / H37RV
    EC Number2.7.7.6
    Expression System Taxid866768
    GeneRPOB, RV0667, MTCI376.08C
    Organism Taxid83332
    StrainATCC 25618 / H37RV
    EC Number2.7.7.6
    Expression System Taxid866768
    GeneRPOC, RV0668, MTCI376.07C
    Organism Taxid83332
    StrainATCC 25618 / H37RV
    EC Number2.7.7.6
    Expression System Taxid866768
    GeneRPOZ, RV1390, MTCY21B4.07
    Organism Taxid83332
    StrainATCC 25618 / H37RV
    Expression System Taxid866768
    GeneSIGA, MYSA, RPOD, RPOV, RV2703, MTCY05A6.24
    Organism Taxid83332
    StrainATCC 25618 / H37RV
    Organism Taxid83332
Molecule 7 - DNA (5'-D(*CP*AP*TP*CP*CP*GP*TP*GP*AP*GP*TP*CP*CP*AP*GP*G)- 3')
    Organism Taxid83332

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCDEFGH

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 4)

Asymmetric/Biological Unit (3, 4)
No.NameCountTypeFull Name
3ZN2Ligand/IonZINC ION

(-) Sites  (4, 4)

Asymmetric Unit (4, 4)
1AC1SOFTWARECYS D:891 , CYS D:968 , CYS D:975 , CYS D:978binding site for residue ZN D 1401
2AC2SOFTWARECYS D:60 , CYS D:62 , CYS D:75 , CYS D:78binding site for residue ZN D 1402
3AC3SOFTWAREASP D:535 , ASP D:537 , ASP D:539binding site for residue MG D 1403
4AC4SOFTWAREVAL C:475 , PRO C:477 , GLY C:566 , VAL C:568 , ARG D:834 , PRO D:835 , LEU D:847 , GLU D:848 , PHE D:850 , ILE D:851 , HIS D:854binding site for residue 88G D 1404

(-) SS Bonds  (2, 2)

Asymmetric/Biological Unit
1D:62 -D:78
2D:975 -D:978

(-) Cis Peptide Bonds  (7, 7)

Asymmetric/Biological Unit
1Glu A:24 -Pro A:25
2Glu B:24 -Pro B:25
3Ser C:94 -Pro C:95
4Val D:110 -Pro D:111
5Ala D:501 -Pro D:502
6Leu D:677 -Pro D:678
7Asn E:37 -Pro E:38

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5UHE)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5UHE)

(-) Exons   (0, 0)

(no "Exon" information available for 5UHE)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:224
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       142       152       162       172       182       192       202       212       222    

Chain B from PDB  Type:PROTEIN  Length:224
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...eeeee....eeeeeeeee...hhhhhhhhhhhhhh...eeeeeeeeee...............hhhhhhhhhhh..eee.....eeeeeeee..eee..........eee.......eee....eeeeeeeeeeee....hhhhh....eee.......eeeeeeeeee.........eeeeeeeee....hhhhhhhhhhhhhhhhhhhhhh........ Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    15        25        35        45        55        65        75        85        95       105       115       125       135       145       158       168       178       188       198       208       218       228    

Chain C from PDB  Type:PROTEIN  Length:1126
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257       267       277       287       297       307       317       327       337       347       357       367       377       387       397       407       417       427       437       447       457       467       477       487       497       507       517       527       537       547       557       567       577       587       597       607       617       627       637       647       657       667       677       687       697       707       717       727       737       747       757       767       777       787       797       807       817       827       837       847       857       867       877       887       897       907       917       927       937       947       957       967       977       987       997      1007      1017      1027      1037      1047      1057      1067      1077      1087      1097      1107      1117      1127      1137      1147      

Chain D from PDB  Type:PROTEIN  Length:1265
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ......eeeeee.hhhhhhhhh...........................................................hhhhhhh..eeeeeeeeeehhhhhh...hhhhhhh..hhhhhhhhhh...eeeeeehhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh....eee.hhhhhhhhhhhhh..eeee.hhhhhhhhhhh.hhhhhhhhhhhhhh..hhhhhhhhhhhhhhhhhhhh...hhhh.eeeeeee.hhhhh.eee.....eee.hhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    12        22        32        42        52        62        72        82        92       102       112       122       132       142       152       162       172       182       192       202       212       222       232       242       252       262       272       282       292       302       312       322       332       342       352       362       372       382       392       402       412       422       432       442       452       462       472       482       492       502       512       522       532       542       552       562       572       582       592       602       612       622       632       642       652       662       672       682       692       702       712       722       732       742       752       762       772       782       792       802       812       822       832       842       852       862       872       882       892       902       912       922       932       942       952       962       972       982       992      1002      1026      1036      1046      1056      1066      1076      1086      1096      1106      1116      1126      1136      1146      1156      1166      1176      1186      1196      1206      1216      1226      1236      1246      1256      1266      1276     

Chain E from PDB  Type:PROTEIN  Length:81
               SCOP domains --------------------------------------------------------------------------------- SCOP domains
               CATH domains --------------------------------------------------------------------------------- CATH domains
               Pfam domains --------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .....hhhhh.hhhhhhhh..hhhhhhhhhhhhhhhhhhhhhhh..................hhhhhhhhhhhh..eeee. Sec.struct. author
                 SAPs(SNPs) --------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE --------------------------------------------------------------------------------- PROSITE
                 Transcript --------------------------------------------------------------------------------- Transcript
                                    37        47        57        67        77        87        97       107 

Chain F from PDB  Type:PROTEIN  Length:322
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                   216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496       506       516       526  

Chain G from PDB  Type:DNA  Length:13
                5uhe G    5 CATCCGTGAGTCG   17

Chain H from PDB  Type:DNA  Length:23
                5uhe H    1 TATAATGGGAGCTGTCACGGATG   23
                                    10        20   

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5UHE)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5UHE)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5UHE)

(-) Gene Ontology  (23, 54)

Asymmetric/Biological Unit(hide GO term definitions)


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    88G  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    MG  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
  Cis Peptide Bonds
    Ala D:501 - Pro D:502   [ RasMol ]  
    Asn E:37 - Pro E:38   [ RasMol ]  
    Glu A:24 - Pro A:25   [ RasMol ]  
    Glu B:24 - Pro B:25   [ RasMol ]  
    Leu D:677 - Pro D:678   [ RasMol ]  
    Ser C:94 - Pro C:95   [ RasMol ]  
    Val D:110 - Pro D:111   [ RasMol ]  

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        RPOA_MYCTU | P9WGZ15uh5 5uh6 5uh8 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg
        RPOB_MYCTU | P9WGY94kbj 4kbm 5uh5 5uh6 5uh8 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg
        RPOC_MYCTU | P9WGY75uh5 5uh6 5uh7 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg
        RPOZ_MYCTU | P9WGY55uh5 5uh6 5uh8 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg
        SIGA_MYCTU | P9WGI14x8k 5uh5 5uh6 5uh8 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg

(-) Related Entries Specified in the PDB File

5uh6 5uh7 5uh8 5uh9 5uha 5uhb 5uhc 5uhd 5uhf 5uhg