Show PDB file:   
         Plain Text   HTML   (compressed file size)
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)

(-) Description

Authors :  R. Glyde, F. Z. Ye, V. C. Darbari, N. Zhang, M. Buck, X. D. Zhang
Date :  26 Apr 17  (Deposition) - 28 Jun 17  (Release) - 28 Jun 17  (Revision)
Resolution :  5.80
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,I,J,K,L,M,N
Keywords :  Transcription Initiation, Transcription Intermediate Complex, Rna Polymerase, Sigma54, Transcription (Keyword Search: [Gene Ontology, PubMed, Web (Google))
Reference :  R. Glyde, F. Ye, V. C. Darbari, N. Zhang, M. Buck, X. Zhang
Structures Of Rna Polymerase Closed And Intermediate Complexes Reveal Mechanisms Of Dna Opening And Transcriptio Initiation.
Mol. Cell 2017
PubMed-ID: 28579332  |  Reference-DOI: 10.1016/J.MOLCEL.2017.05.010

(-) Compounds

    ChainsA, B
    EC Number2.7.7.6
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPGEM
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Expression System Vector TypePLASMID
    GeneRPOA, PEZ, PHS, SEZ, B3295, JW3257
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    EC Number2.7.7.6
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPET28B+
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Expression System Vector TypePLASMID
    GeneRPOB, GRON, NITB, RIF, RON, STL, STV, TABD, B3987, JW3950
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    EC Number2.7.7.6,,
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    GeneRPOC, TABB, B3988, JW3951
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    EC Number2.7.7.6
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPGEM
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Expression System Vector TypePLASMID
    GeneRPOZ, B3649, JW3624
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    ChainsF, G, J, K, L, N
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPGEM
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Expression System Vector TypePLASMID
    GenePSPF, YCJB, B1303, JW1296
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPET28B+
    Expression System Taxid469008
    Expression System Vector TypePLASMID
    Organism ScientificESCHERICHIA COLI K-12
    Organism Taxid83333
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System PlasmidPGEM
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Expression System Vector TypePLASMID
    GeneRPON, KPST82_0597, SAMEA3531778_03572, SM87_03359, SAMEA4362693_02699, SM87_03359, SAMEA4362708_00719
    Organism ScientificKLEBSIELLA PNEUMONIAE
    Organism Taxid573
    Expression SystemESCHERICHIA COLI BL21(DE3)
    Expression System Taxid469008
    Expression System VariantGOLD PLYSS AG
    Organism ScientificKLEBSIELLA PNEUMONIAE
    Organism Taxid573

 Structural Features

(-) Chains, Units

Asymmetric/Biological Unit ABCDEFGHIJKLMN

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 146)

Asymmetric/Biological Unit (1, 146)
No.NameCountTypeFull Name
1UNK146Mod. Amino Acid

(-) Sites  (0, 0)

(no "Site" information available for 5NSS)

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5NSS)

(-) Cis Peptide Bonds  (2, 2)

Asymmetric/Biological Unit
1Glu B:29 -Pro B:30
2Phe C:57 -Pro C:58

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5NSS)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5NSS)

(-) Exons   (0, 0)

(no "Exon" information available for 5NSS)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:238
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71        81        91       101       111       121       131       141       151       161       171       181       191       201       211       221       231        

Chain B from PDB  Type:PROTEIN  Length:235
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    13        23        33        43        53        63        73        83        93       103       113       123       133       143       153       163       173       183       193       203       213       223       233     

Chain C from PDB  Type:PROTEIN  Length:1340
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    10        20        30        40        50        60        70        80        90       100       110       120       130       140       150       160       170       180       190       200       210       220       230       240       250       260       270       280       290       300       310       320       330       340       350       360       370       380       390       400       410       420       430       440       450       460       470       480       490       500       510       520       530       540       550       560       570       580       590       600       610       620       630       640       650       660       670       680       690       700       710       720       730       740       750       760       770       780       790       800       810       820       830       840       850       860       870       880       890       900       910       920       930       940       950       960       970       980       990      1000      1010      1020      1030      1040      1050      1060      1070      1080      1090      1100      1110      1120      1130      1140      1150      1160      1170      1180      1190      1200      1210      1220      1230      1240      1250      1260      1270      1280      1290      1300      1310      1320      1330      1340

Chain D from PDB  Type:PROTEIN  Length:1352
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ...........hhhhhhhhhh............................................................ Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    24        34        44        54||||||||65||||||||75||||||||85||||||||95|||    106       116       126       136       146       156       166       176       186       196       206       216       226       236       246       256       266       276       286       296       306       316       326       336       346       356       366       376       386       396       406       416       426       436       446       456       466       476       486       496       506       516       526       536       546       556       566       576       586       596       606       616       626       636       646       656       666       676       686       696       706       716       726       736       746       756       766       776       786       796       806       816       826       836       846       856       866       876       886       896       906       916       926       936       946       956       966       976       986       996      1006      1016      1026      1036      1046||    1064      1074      1084      1094      1104      1114      1124      1134      1144      1154      1164      1174      1184      1194      1204      1214      1224      1234      1244      1254      1264      1274      1284      1294      1304      1314      1324      1334      1344      1354      1364      1374  
                                                                  54|||||||64-UNK|||73-UNK|||82-UNK|||91-UNK|||                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                1047|                                                                                                                                                                                                                                                                                                                                
                                                                   56-UNK|||65-UNK|||74-UNK|||83-UNK|||92-UNK||                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 1056                                                                                                                                                                                                                                                                                                                                
                                                                    57-UNK|| 66-UNK|| 75-UNK|| 84-UNK|| 93-UNK|                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                     58-UNK|  67-UNK|  76-UNK|  85-UNK|  94-UNK                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                      59-UNK   68-UNK   77-UNK   86-UNK   95-UNK                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                       60-UNK   69-UNK   78-UNK   87-UNK   96-UNK                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                        61-UNK   70-UNK   79-UNK   88-UNK   97-UNK                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                         62-UNK   71-UNK   80-UNK   89-UNK   99                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                          63-UNK   72-UNK   81-UNK   90-UNK                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         

Chain E from PDB  Type:PROTEIN  Length:74
               SCOP domains -------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhh....hhhhhhhhhhhhhhhh...........hhhhhhhhhhhhh..hhhhhhhhhhhhhhhh Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------- Transcript
                                    11        21        31        41        51        61        71    

Chain F from PDB  Type:PROTEIN  Length:248
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhh.....eee......hhhhhhhhhhhhhhhhhh...eee....hhhhhhhhhhh................hhhhh.eeeeee.....hhhhhhhhhhhhhhh..............eeeeee...hhhhhhhhh..hhhhhhhhh..........hhhhhhhhhhhhhhhhhh...........hhhhhhhhhhh...hhhhhhhhhhhhhhhhhh.............. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247        

Chain G from PDB  Type:PROTEIN  Length:251
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257 

Chain H from PDB  Type:DNA  Length:35
                                    71        81        91     

Chain I from PDB  Type:DNA  Length:31
                5nss I  -34 AGACGGCTGGCACGACTTTTGCCAAGCCCTG    0
                                   -25       -15   ||   -1 

Chain J from PDB  Type:PROTEIN  Length:251
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhh......eeee.....hhhhhhhhhhhhhhhhh...eeee....hhhhhhhhh...............hhhhhhhh...eeee.hhhhhhhhhhhhhhhhhhh................eeeee..hhhhhhhh...hhhhhhhh..eeee......hhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhh....hhhhhhhhhhhhhhhhh................. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257 

Chain K from PDB  Type:PROTEIN  Length:248
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247        

Chain L from PDB  Type:PROTEIN  Length:250
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257

Chain M from PDB  Type:PROTEIN  Length:388
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhhhhhhh....hhhhhhhhhhh..........hhhhhhhhhh....hhhhhhhhhhhh...........hhhhhhhhh........hhhhhhhhhh...........hhhhhhhhhh......hhhhhhhhhhh...................hhhhhhhhhhhhh........................................................hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh.............hhhhhh...hhhhhhhhhhhh...........................hhhhhhhhhhh.........hhhhhhhhhhhh......hhhhhhhhh............. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                            ||||||||17||||||||27||||||||37||||||||47|||    127       137       147       157       167       177       187       197       207       217       227       237       247       257|||||||268|||||||278|||||||288|||||||298|||||||309 ||    327       337       347       357       367       377       387       398|||||||408|||||| 419       429       439       449       459       469        
                            8-UNK|||17-UNK|||26-UNK|||35-UNK|||44-UNK||                                                                                                                                      257||||||267-UNK||276-UNK||285-UNK||294-UNK||303-UNK311|                                                                         396||||||406-UNK||||                                                              
                             9-UNK|||18-UNK|||27-UNK|||36-UNK|||45-UNK|                                                                                                                                       259-UNK||268-UNK||277-UNK||286-UNK||295-UNK||304-UNK320                                                                          398-UNK||407-UNK|||                                                              
                             10-UNK|| 19-UNK|| 28-UNK|| 37-UNK|| 46-UNK                                                                                                                                        260-UNK||269-UNK||278-UNK||287-UNK||296-UNK||306                                                                                 399-UNK||408-UNK||                                                              
                              11-UNK|  20-UNK|  29-UNK|  38-UNK|  47-UNK                                                                                                                                        261-UNK| 270-UNK| 279-UNK| 288-UNK| 297-UNK|                                                                                     400-UNK| 409-UNK|                                                              
                               12-UNK   21-UNK   30-UNK   39-UNK   48-UNK                                                                                                                                        262-UNK  271-UNK  280-UNK  289-UNK  298-UNK                                                                                      401-UNK  410-UNK                                                              
                                13-UNK   22-UNK   31-UNK   40-UNK   49-UNK                                                                                                                                        263-UNK  272-UNK  281-UNK  290-UNK  299-UNK                                                                                      402-UNK  411-UNK                                                             
                                 14-UNK   23-UNK   32-UNK   41-UNK  120                                                                                                                                            264-UNK  273-UNK  282-UNK  291-UNK  300-UNK                                                                                      403-UNK  412-UNK                                                            
                                  15-UNK   24-UNK   33-UNK   42-UNK                                                                                                                                                 265-UNK  274-UNK  283-UNK  292-UNK  301-UNK                                                                                      404-UNK  413-UNK                                                           
                                   16-UNK   25-UNK   34-UNK   43-UNK                                                                                                                                                 266-UNK  275-UNK  284-UNK  293-UNK  302-UNK                                                                                      405-UNK  415                                                              

Chain N from PDB  Type:PROTEIN  Length:251
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author ....hhhhhhhhhhhhhhh.....eee......hhhhhhhhhhhhhhhhhh..eeee....hhhhhhhhhhh..............hhhhhh....eeee.....hhhhhhhhhhhhhhh................eeee...hhhhhhhh...hhhhhhhhh......hhhhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhh......hhhhhhhhhhhhhhhhh................. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                                    17        27        37        47        57        67        77        87        97       107       117       127       137       147       157       167       177       187       197       207       217       227       237       247       257 

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5NSS)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5NSS)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5NSS)

(-) Gene Ontology  (23, 52)

Asymmetric/Biological Unit(hide GO term definitions)


(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
  Ligands, Modified Residues, Ions
    UNK  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
(no "Sites" information available for 5nss)
  Cis Peptide Bonds
    Glu B:29 - Pro B:30   [ RasMol ]  
    Phe C:57 - Pro C:58   [ RasMol ]  

(-) Still Images

  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
Access by UniProt ID/Accession number
  PSPF_ECOLI | P37344
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
Access by Enzyme Classificator   (EC Number)
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
Access by UniProt ID/Accession number
  PSPF_ECOLI | P37344
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

        PSPF_ECOLI | P373442bjv 2bjw 2c96 2c98 2c99 2c9c 2vii 4qnm 4qnr 4qos
        RPOA_ECOLI | P0A7Z41bdf 1coo 1lb2 1xs9 2jzb 3iyd 3k4g 3lu0 3n4m 3n97 4jk1 4jk2 4kmu 4kn4 4kn7 4mex 4mey 4s20 4xsx 4xsy 4xsz 4yg2 4yln 4ylo 4ylp 4zh2 4zh3 4zh4 5byh 5ciz 5ezk 5ipl 5ipm 5ipn 5ms0 5my1 5nsr 5uac 5uag 5uah 5uaj 5ual 5uaq 5up6 5upc 5vsw 5w1s 5w1t
        RPOB_ECOLI | P0A8V23iyd 3lti 3lu0 3t72 3tbi 4jk1 4jk2 4kmu 4kn4 4kn7 4mex 4mey 4s20 4xsx 4xsy 4xsz 4yg2 4yln 4ylo 4ylp 4zh2 4zh3 4zh4 5byh 5ezk 5ipl 5ipm 5ipn 5ms0 5nsr 5uac 5uag 5uah 5uaj 5ual 5uaq 5up6 5upc 5vsw 5w1s 5w1t
        RPOC_ECOLI | P0A8T72auk 2lmc 3iyd 3lu0 4iqz 4jk1 4jk2 4kmu 4kn4 4kn7 4mex 4mey 4xsx 4xsy 4xsz 4yg2 4yln 4ylo 4ylp 4zh2 4zh3 4zh4 5byh 5ezk 5ipl 5ipm 5ipn 5my1 5nsr 5uac 5uag 5uah 5uaj 5ual 5uaq 5up6 5upc 5vsw 5w1s 5w1t
        RPOZ_ECOLI | P0A8003iyd 3lu0 4jk1 4jk2 4kmu 4kn4 4kn7 4mex 4mey 4xsx 4xsy 4xsz 4yg2 4yln 4ylo 4ylp 4zh2 4zh3 4zh4 5byh 5ezk 5ipl 5ipm 5ipn 5ms0 5nsr 5uac 5uag 5uah 5uaj 5ual 5uaq 5up6 5upc 5vsw 5w1s 5w1t

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5NSS)