Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  STRUCTURE DETERMINATION OF A SELF-ASSEMBLING DNA CRYSTAL
 
Authors :  C. R. Simmons, J. J. Birktoft, N. C. Seeman, H. Yan
Date :  09 Jun 16  (Deposition) - 10 Aug 16  (Release) - 24 Aug 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.10
Chains :  Asym./Biol. Unit :  A,B,C,D
Keywords :  Structural Dna Nanoechnology, Self-Assembled Crystals, Self-Assembly, Dna (Keyword Search: [Gene Ontology, PubMed, Web (Google)] )
 
Reference :  C. R. Simmons, F. Zhang, J. J. Birktoft, X. Qi, D. Han, Y. Liu, R. Sha, H. O. Abdallah, C. Hernandez, Y. P. Ohayon, N. C. Seeman, H. Yan
Construction And Structure Determination Of A Three-Dimensional Dna Crystal.
J. Am. Chem. Soc. V. 138 10047 2016
PubMed-ID: 27447429  |  Reference-DOI: 10.1021/JACS.6B06508

(-) Compounds

Molecule 1 - DNA (5'- D(*GP*AP*GP*CP*AP*GP*AP*CP*CP*TP*GP*AP*CP*GP*AP*CP*AP*CP*TP*CP*A)- 3')
    Chains: A
    Engineered: YES
    Organism Scientific: ENDOTHIA GYROSA
    Organism Taxid: 40263
    Synthetic: YES
 
Molecule 2 - DNA (5'-D(P*CP*GP*TP*CP*A)-3')
    Chains: B
    Engineered: YES
    Organism Scientific: ENDOTHIA GYROSA
    Organism Taxid: 40263
    Synthetic: YES
 
Molecule 3 - DNA (5'-D(*TP*CP*TP*GP*AP*GP*TP*GP*T)-3')
    Chains: C
    Engineered: YES
    Organism Scientific: ENDOTHIA GYROSA
    Organism Taxid: 40263
    Synthetic: YES
 
Molecule 4 - DNA (5'-D(P*GP*GP*TP*CP*TP*GP*C)-3')
    Chains: D
    Engineered: YES
    Organism Scientific: ENDOTHIA GYROSA
    Organism Taxid: 40263
    Synthetic: YES

 Structural Features

(-) Chains, Units

  1234
Asymmetric/Biological Unit : ABCD

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (1, 2)

Asymmetric/Biological Unit (1, 2)
No.NameCountTypeFull Name
1CAC2Ligand/IonCACODYLATE ION

(-) Sites  (2, 2)

Asymmetric Unit (2, 2)
No.NameEvidenceResiduesDescription
1AC1SOFTWAREDT C:9binding site for residue CAC C 101
2AC2SOFTWAREDG D:11binding site for residue CAC D 101

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5KEK)

(-) Cis Peptide Bonds  (0, 0)

(no "Cis Peptide Bond" information available for 5KEK)

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5KEK)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5KEK)

(-) Exons   (0, 0)

(no "Exon" information available for 5KEK)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it) 
Chain A from PDB  Type:DNA  Length:21
                                                    
                  5kek A  1 GAGCAGACCTGACGACACTCA 21
                                    10        20 


Chain B from PDB  Type:DNA  Length:5
                                    
                  5kek B  1 CGTCA  5


Chain C from PDB  Type:DNA  Length:9
                                        
                  5kek C  1 TCTGAGTGT  9


Chain D from PDB  Type:DNA  Length:7
                                      
                  5kek D 10 GGTCTGC 16
   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5KEK)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5KEK)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5KEK)

(-) Gene Ontology  (0, 0)

Asymmetric/Biological Unit(hide GO term definitions)
    (no "Gene Ontology" information available for 5KEK)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    CAC  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
(no "Cis Peptide Bonds" information available for 5kek)
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
[ Asym./Biol. Unit PNG format | Asym./Biol. Unit - sites PNG format ](automatic orientation, automatically generated)
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick
[ mono PDF format | stereo PDF format ](default orientation, automatically generated)

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5kek
    Family and Domain Information: ProDom | SYSTERS
    General Structural Information: GlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in Membranes: OPM
    Protein Surface: SURFACE
    Secondary Structure: DSSP | HSSP
    Structural Genomics: GeneCensus
    Structural Neighbours: CE | VAST
    Structure Classification: CATH | Dali | SCOP
    Validation and Original Data: BMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Comparative Protein Structure Models: ModBase
    Genomic Information: Ensembl
    Protein-protein Interaction: DIP
    Sequence, Family and Domain Information: InterPro | Pfam | SMART | UniProt
 
Access by Enzyme Classificator   (EC Number)
  (no 'Enzyme Classificator' available)
    General Enzyme Information: BRENDA | EC-PDB | Enzyme | IntEnz
    Pathway: KEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease Information: OMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related Information: GenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain Information: XDom
    Interatomic Contacts of Structural Units: CSU
    Ligand-protein Contacts: LPC
    Protein Cavities: castP
    Sequence and Secondary Structure: PDBCartoon
    Structure Alignment: STRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence Browser: STING
 
Access by UniProt ID/Accession number
  (no 'UniProt ID/Accession number' available) |
    Protein Disorder Prediction: DisEMBL | FoldIndex | GLOBPLOT

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

(no "Entries Sharing at Least One Protein Chain" available for 5KEK)

(-) Related Entries Specified in the PDB File

5keo