Show PDB file:   
         Plain Text   HTML   (compressed file size)
QuickSearch:   
by PDB,NDB,UniProt,PROSITE Code or Search Term(s)  
(-)Asym./Biol. Unit
(-)Asym./Biol. Unit - sites
collapse expand < >
Image Asym./Biol. Unit
Asym./Biol. Unit  (Jmol Viewer)
Image Asym./Biol. Unit - sites
Asym./Biol. Unit - sites  (Jmol Viewer)

(-) Description

Title :  CRYSTAL STRUCTURE OF THE ROUS SARCOMA VIRUS INTASOME
 
Authors :  Z. Yin, K. Shi, S. Banerjee, H. Aihara
Date :  02 Nov 15  (Deposition) - 17 Feb 16  (Release) - 02 Mar 16  (Revision)
Method :  X-RAY DIFFRACTION
Resolution :  3.80
Chains :  Asym./Biol. Unit :  A,B,C,D,E,F,G,H,I,J,K,L,M,N,k,n
Keywords :  Rsv, Integrase, Intasome, Transferase-Dna Complex (Keyword Search: [Gene Ontology, PubMed, Web (Google))
 
Reference :  Z. Yin, K. Shi, S. Banerjee, K. K. Pandey, S. Bera, D. P. Grandgenett, H. Aihara
Crystal Structure Of The Rous Sarcoma Virus Intasome.
Nature V. 530 362 2016
PubMed-ID: 26887497  |  Reference-DOI: 10.1038/NATURE16950

(-) Compounds

Molecule 1 - GAG-PRO-POL POLYPROTEIN
    ChainsA, B, C, D, E, F, G, H
    EC Number3.4.23.-, 2.7.7.49, 2.7.7.7, 3.1.26.4, 2.7.7.-, 3.1.-.-
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    FragmentUNP RESIDUES 573-842
    GeneGAG-PRO-POL
    MutationYES
    Organism CommonRSV-PRC
    Organism ScientificROUS SARCOMA VIRUS (STRAIN PRAGUE C)
    Organism Taxid11888
    StrainPRAGUE C
 
Molecule 2 - RSV INTEGRASE
    ChainsI, L
    EngineeredYES
    Expression SystemESCHERICHIA COLI
    Expression System Taxid562
    Organism ScientificROUS SARCOMA VIRUS (STRAIN SCHMIDT-RUPPIN E)
    Organism Taxid270623
 
Molecule 3 - DNA (5'- D(*AP*AP*TP*GP*TP*TP*GP*TP*CP*TP*TP*AP*TP*GP*CP*AP*AP*TP*AP*CP*TP*C)- 3')
    ChainsJ, M
    EngineeredYES
    Organism ScientificROUS SARCOMA VIRUS (STRAIN SCHMIDT-RUPPIN E)
    Organism Taxid270623
    SyntheticYES
 
Molecule 4 - DNA (5'-D(*CP*TP*TP*CP*TP*CP*TP*C)-3')
    ChainsK, N
    EngineeredYES
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SyntheticYES
 
Molecule 5 - DNA (5'-D(*AP*GP*TP*GP*TP*CP*TP*T)-3')
    Chainsk, n
    EngineeredYES
    Organism ScientificHOMO SAPIENS
    Organism Taxid9606
    SyntheticYES

 Structural Features

(-) Chains, Units

  12345678910111213141516
Asymmetric/Biological Unit ABCDEFGHIJKLMNkn

Summary Information (see also Sequences/Alignments below)

(-) Ligands, Modified Residues, Ions  (3, 132)

Asymmetric/Biological Unit (3, 132)
No.NameCountTypeFull Name
1MSE88Mod. Amino AcidSELENOMETHIONINE
2W36Ligand/IonTUNGSTEN ION
3ZN8Ligand/IonZINC ION

(-) Sites  (43, 43)

Asymmetric Unit (43, 43)
No.NameEvidenceResiduesDescription
01AC1SOFTWAREHIS A:9 , HIS A:13 , CYS A:37 , CYS A:40binding site for residue ZN A 301
02AC2SOFTWAREW A:303 , W A:304 , W B:320binding site for residue W A 302
03AC3SOFTWAREW A:302 , W B:314 , W B:321binding site for residue W A 303
04AC4SOFTWAREW A:302 , W B:314 , W B:318binding site for residue W A 304
05AC5SOFTWAREHIS B:9 , HIS B:13 , CYS B:37 , CYS B:40binding site for residue ZN B 301
06AC6SOFTWAREW B:307 , W B:308 , W B:310 , W B:312binding site for residue W B 302
07AC7SOFTWAREW B:307 , W B:308 , W B:313binding site for residue W B 303
08AC8SOFTWAREW B:306 , W B:311 , W B:312 , W B:313binding site for residue W B 304
09AC9SOFTWAREW B:306 , W B:309 , W B:310 , W B:311binding site for residue W B 305
10AD1SOFTWAREW B:304 , W B:305 , W B:309 , W B:313binding site for residue W B 306
11AD2SOFTWAREW B:302 , W B:303 , W B:313binding site for residue W B 307
12AD3SOFTWAREW B:302 , W B:303 , W B:309 , W B:310binding site for residue W B 308
13AD4SOFTWAREW B:305 , W B:306 , W B:308binding site for residue W B 309
14AD5SOFTWAREW B:302 , W B:305 , W B:308binding site for residue W B 310
15AD6SOFTWAREW B:304 , W B:305 , W B:312binding site for residue W B 311
16AD7SOFTWAREW B:302 , W B:304 , W B:311binding site for residue W B 312
17AD8SOFTWAREW B:303 , W B:304 , W B:306 , W B:307binding site for residue W B 313
18AD9SOFTWAREARG A:74 , W A:303 , W A:304 , ARG B:74 , W B:321binding site for residue W B 314
19AE1SOFTWAREW B:317 , W B:319 , W B:320 , W B:321binding site for residue W B 315
20AE2SOFTWAREW B:317 , W B:318 , W B:319binding site for residue W B 316
21AE3SOFTWAREW B:315 , W B:316 , W B:318 , W B:321binding site for residue W B 317
22AE4SOFTWAREW A:304 , ARG B:74 , W B:316 , W B:317binding site for residue W B 318
23AE5SOFTWAREW B:315 , W B:316 , W B:320binding site for residue W B 319
24AE6SOFTWAREW A:302 , W B:315 , W B:319binding site for residue W B 320
25AE7SOFTWAREW A:303 , PRO B:73 , W B:314 , W B:315 , W B:317binding site for residue W B 321
26AE8SOFTWAREHIS C:9 , HIS C:13 , CYS C:37 , CYS C:40binding site for residue ZN C 301
27AE9SOFTWAREHIS D:9 , HIS D:13 , CYS D:37 , CYS D:40binding site for residue ZN D 301
28AF1SOFTWAREHIS E:9 , HIS E:13 , CYS E:37 , CYS E:40binding site for residue ZN E 301
29AF2SOFTWAREHIS F:9 , HIS F:13 , CYS F:37 , CYS F:40binding site for residue ZN F 301
30AF3SOFTWAREW F:307 , W F:309 , W F:311 , W G:301binding site for residue W F 302
31AF4SOFTWAREW F:307 , W F:312 , W G:301binding site for residue W F 303
32AF5SOFTWAREW F:306 , W F:310 , W F:311 , W F:312binding site for residue W F 304
33AF6SOFTWAREW F:306 , W F:308 , W F:309 , W F:310binding site for residue W F 305
34AF7SOFTWAREARG F:70 , W F:304 , W F:305 , W F:308 , W F:312binding site for residue W F 306
35AF8SOFTWAREW F:302 , W F:303 , W F:308 , W F:309binding site for residue W F 307
36AF9SOFTWAREW F:305 , W F:306 , W F:307binding site for residue W F 308
37AG1SOFTWAREW F:302 , W F:305 , W F:307binding site for residue W F 309
38AG2SOFTWAREW F:304 , W F:305 , W F:311binding site for residue W F 310
39AG3SOFTWAREW F:302 , W F:304 , W F:310binding site for residue W F 311
40AG4SOFTWAREW F:303 , W F:304 , W F:306 , W G:301binding site for residue W F 312
41AG5SOFTWAREW F:302 , W F:303 , W F:312binding site for residue W G 301
42AG6SOFTWAREHIS G:9 , HIS G:13 , CYS G:37 , CYS G:40binding site for residue ZN G 302
43AG7SOFTWAREHIS H:9 , HIS H:13 , CYS H:37 , CYS H:40binding site for residue ZN H 301

(-) SS Bonds  (0, 0)

(no "SS Bond" information available for 5EJK)

(-) Cis Peptide Bonds  (18, 18)

Asymmetric/Biological Unit
No.Residues
1Ser A:42 -Ala A:43
2Ala A:43 -Pro A:44
3Ala A:72 -Pro A:73
4Ala B:72 -Pro B:73
5Gln B:151 -Gly B:152
6Ala C:72 -Pro C:73
7Ile C:146 -Pro C:147
8Arg C:214 -Pro C:215
9Ala D:72 -Pro D:73
10Pro D:222 -Pro D:223
11Asn E:51 -Pro E:52
12Ala E:72 -Pro E:73
13Ala F:72 -Pro F:73
14Ala G:72 -Pro G:73
15Ser H:42 -Ala H:43
16Ala H:43 -Pro H:44
17Ala H:72 -Pro H:73
18Pro H:222 -Pro H:223

 Sequence-Structure Mapping

(-) SAPs(SNPs)/Variants  (0, 0)

(no "SAP(SNP)/Variant" information available for 5EJK)

(-) PROSITE Motifs  (0, 0)

(no "PROSITE Motif" information available for 5EJK)

(-) Exons   (0, 0)

(no "Exon" information available for 5EJK)

(-) Sequences/Alignments

Asymmetric/Biological Unit
   Reformat: Number of residues per line =  ('0' or empty: single-line sequence representation)
  Number of residues per labelling interval =   
  UniProt sequence: complete  aligned part    
   Show mapping: SCOP domains CATH domains Pfam domains Secondary structure (by author)
SAPs(SNPs) PROSITE motifs Exons
(details for a mapped element are shown in a popup box when the mouse pointer rests over it)
Chain A from PDB  Type:PROTEIN  Length:269
                                                                                                                                                                                                                                                                                                             
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author hhhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhh.......................eeeeeeee.hhhh...eeeeeee.....eeeeee...hhhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhh.eee.........hhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhh........hhhhhhh.........eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk A   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCNSAPALEAGVNPRGLGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40        50        60        70|       80        90       100       110 |     120       130    |  140       150    |  160 ||    170      |180       190  |    200       210       220       230       240       250       260         
                                                     27-MSE                                      71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                                                                            
                                                                                                                                                                                           162-MSE                    189-MSE                                                                            
                                                                                                                                                                                            163-MSE                       193-MSE                                                                        

Chain B from PDB  Type:PROTEIN  Length:253
                                                                                                                                                                                                                                                                                             
               SCOP domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhhh......eeeeeeee........eeeeeee.....eeeeee...hhhhhhhhhhhhhhhhh...eee...hhhhhhhhhhhhhhhhh.eee.........hhhhhhhhhhhhhhhhhhhhhhh........hhhhhhhhhhhhhhhh.......hhhhhhhh........eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk B   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40|       66    |   76        86        96       106     | 116       126       136       146       156     ||166       176|      186 ||   |196       206       216       226       236       246       256       266   
                                                     27-MSE       40|            71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                                                                            
                                                                   57                                                                                                      162-MSE                    189-MSE                                                                            
                                                                                                                                                                            163-MSE                       193-MSE                                                                        

Chain C from PDB  Type:PROTEIN  Length:256
                                                                                                                                                                                                                                                                                                
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhhh.........eeeeeeee.hhhh...eeeeeee.....eeeeee...hhhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhh.eee..........hhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhhhh........................eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk C   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCGLGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40|       63       |73        83        93       103       113       123       133 |     143       153 |     163       173   |   183    || 193       203       213       223       233       243       253       263      
                                                     27-MSE       40|               71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                                                                            
                                                                   54                                                                                                         162-MSE                    189-MSE                                                                            
                                                                                                                                                                               163-MSE                       193-MSE                                                                        

Chain D from PDB  Type:PROTEIN  Length:250
                                                                                                                                                                                                                                                                                          
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhhh...........eeeeee..hhhhh...eeeee.....eee......hhhhhhhhhhhhhhhh....eeeee......hhhhhhhhhhh..eeeee..hhhhhhhhhhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh....................eeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk D   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCPRGLGPLQIWQTDFTLEPRmAPWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWREGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40|       61        71 ||     83        93       103       113       123       133 |     143  ||   154|      164       174  |    184   ||  194       204       214|      229       239       249       259       269
                                                     27-MSE       40|                 71-MSE                                112-MSE                135-MSE    146|      |      ||           177-MSE    188-MSE|                  214|                                                 
                                                                   52                   73|                                                                    148      |      ||                       189-MSE                   220                                                 
                                                                                         76                                                                           155-MSE  ||                           193-MSE                                                                   
                                                                                                                                                                             162-MSE                                                                                                  
                                                                                                                                                                              163-MSE                                                                                                 

Chain E from PDB  Type:PROTEIN  Length:269
                                                                                                                                                                                                                                                                                                             
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhh.......................eeeeeeee.hhhh...eeeeeee.....eeeeee...hhhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhh.eee.........hhhhhhhhhhhhhhhhhhhhhh......hhhhhhhhhhhhhhhh..........hhhhhhhh........eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk E   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCNSAPALEAGVNPRGLGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40        50        60        70|       80        90       100       110 |     120       130    |  140       150    |  160 ||    170      |180       190  |    200       210       220       230       240       250       260         
                                                     27-MSE                                      71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                                                                            
                                                                                                                                                                                           162-MSE                    189-MSE                                                                            
                                                                                                                                                                                            163-MSE                       193-MSE                                                                        

Chain F from PDB  Type:PROTEIN  Length:254
                                                                                                                                                                                                                                                                                              
               SCOP domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhh..hhhhhhhhhhh........eeeeeee.hhhhh...eeeeeee.....eeeeee...hhhhhhhhhhhhhhhh....eee...hhhhhhhhhhhhhhhhh.eee..........hhhhhhhhhhhhhhhhhhhhh.........hhhhhhhhhhhhhhh..........hhhhhh........eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk F   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40|       65     |  75        85        95       105      |115       125       135       145       155      |165       175 |     185  ||   195       205       215       225       235       245       255       265    
                                                     27-MSE       40|             71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                                                                            
                                                                   56                                                                                                       162-MSE                    189-MSE                                                                            
                                                                                                                                                                             163-MSE                       193-MSE                                                                        

Chain G from PDB  Type:PROTEIN  Length:250
                                                                                                                                                                                                                                                                                          
               SCOP domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhh............eeeeeeee.hhhh...eeeeeee....eeeeeee...hhhhhhhhhhhhhhhhh...eee........hhhhhhhhhhh..ee......hhhhhhhhhhhhhhhhhhh.....hhhhhhhhhhhhhhhhhh........hhhhhhh.........eeeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk G   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCPRGLGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40|       61        71        81        91       101       111|      121       131   |   141   ||| 159  ||   169       179       189   |   199       209       219       229       239       249       259       269
                                                     27-MSE       40|                 71-MSE                                  112-MSE                135-MSE   145||      ||           177-MSE    188-MSE|                                                                            
                                                                   52                                                                                           154|      ||                       189-MSE                                                                            
                                                                                                                                                                 155-MSE  ||                           193-MSE                                                                        
                                                                                                                                                                        162-MSE                                                                                                       
                                                                                                                                                                         163-MSE                                                                                                      

Chain H from PDB  Type:PROTEIN  Length:263
                                                                                                                                                                                                                                                                                                       
               SCOP domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SCOP domains
               CATH domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- CATH domains
               Pfam domains ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pfam domains
         Sec.struct. author .hhhhhhhhhhhh.hhhhhhhhhh.hhhhhhhhhhhhhhhhh..............eeeeeeee.hhhh...eeeeeee.....eeeeee...hhhhhhhhhhhhhhhhh...eee........hhhhhhhhhhhh.eee...........hhhhhhhhhhhhhhhhhhh..........hhhhhhhhhhhhhhh........hhhhhhh.......eeee.....eeeeeeeeee...eeeeee.....eeeee...eee.. Sec.struct. author
                 SAPs(SNPs) ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- SAPs(SNPs)
                    PROSITE ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PROSITE
                 Transcript ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Transcript
                 5ejk H   1 PLREAKDLHTALHIGPRALSKASNISmQQAREVVQTCPHCNSAPALEAPRGLGPLQIWQTDFTLEPRmAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVmGRPKAIKTDNGSCFTSKSTREWmARWGIAHTTGIPGNSQGQAmVERANRmmKDKIRVLAEGDGFmKRIPTSKQGEmmAKAmYALNHFERGENTKTPIQKHWRPTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDI 269
                                    10        20      | 30        40       |53        63       |73        83        93       103       113       123       133 |     143       153 |     163       173   |   183    || 193       203       213  ||   226       236       246       256       266   
                                                     27-MSE               48|                 71-MSE                                  112-MSE                135-MSE             155-MSE  ||           177-MSE    188-MSE|                    216|                                                 
                                                                           52                                                                                                           162-MSE                    189-MSE                     220                                                 
                                                                                                                                                                                         163-MSE                       193-MSE                                                                     

Chain I from PDB  Type:DNA  Length:42
                                                                          
                 5ejk I   1 GAGTATTGCATAAGACAACAGTGCACGAAAGAAGAAGACACT  42
                                    10        20        30        40  

Chain J from PDB  Type:DNA  Length:22
                                                      
                 5ejk J   1 AATGTTGTCTTATGCAATACTC  22
                                    10        20  

Chain K from PDB  Type:DNA  Length:8
                                        
                 5ejk K   9 CTTCTTTC  16

Chain L from PDB  Type:DNA  Length:38
                                                                      
                 5ejk L   5 ATTGCATAAGACAACAGTGCACGAAAGAAGAAGACACT  42
                                    14        24        34        

Chain M from PDB  Type:DNA  Length:18
                                                  
                 5ejk M   1 AATGTTGTCTTATGCAAT  18
                                    10        

Chain N from PDB  Type:DNA  Length:8
                                        
                 5ejk N   9 CTTCTTTC  16

Chain k from PDB  Type:DNA  Length:8
                                        
                 5ejk k   1 AGTGTCTT   8

Chain n from PDB  Type:DNA  Length:8
                                        
                 5ejk n   1 AGTGTCTT   8

   Legend:   → Mismatch (orange background)
  - → Gap (green background, '-', border residues have a numbering label)
    → Modified Residue (blue background, lower-case, 'x' indicates undefined single-letter code, labelled with number + name)
  x → Chemical Group (purple background, 'x', labelled with number + name, e.g. ACE or NH2)
  extra numbering lines below/above indicate numbering irregularities and modified residue names etc., number ends below/above '|'

 Classification and Annotation

(-) SCOP Domains  (0, 0)

(no "SCOP Domain" information available for 5EJK)

(-) CATH Domains  (0, 0)

(no "CATH Domain" information available for 5EJK)

(-) Pfam Domains  (0, 0)

(no "Pfam Domain" information available for 5EJK)

(-) Gene Ontology  (30, 30)

Asymmetric/Biological Unit(hide GO term definitions)

 Visualization

(-) Interactive Views

Asymmetric/Biological Unit
  Complete Structure
    Jena3D(integrated viewing of ligand, site, SAP, PROSITE, SCOP information)
    WebMol | AstexViewer[tm]@PDBe
(Java Applets, require no local installation except for Java; loading may be slow)
    STRAP
(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    RasMol
(require local installation)
    Molscript (VRML)
(requires installation of a VRML viewer; select preferred view via VRML and generate a mono or stereo PDF format file)
 
  Ligands, Modified Residues, Ions
    MSE  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    W  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
    ZN  [ RasMol | Jena3D ]  +environment [ RasMol | Jena3D ]
 
  Sites
    AC1  [ RasMol ]  +environment [ RasMol ]
    AC2  [ RasMol ]  +environment [ RasMol ]
    AC3  [ RasMol ]  +environment [ RasMol ]
    AC4  [ RasMol ]  +environment [ RasMol ]
    AC5  [ RasMol ]  +environment [ RasMol ]
    AC6  [ RasMol ]  +environment [ RasMol ]
    AC7  [ RasMol ]  +environment [ RasMol ]
    AC8  [ RasMol ]  +environment [ RasMol ]
    AC9  [ RasMol ]  +environment [ RasMol ]
    AD1  [ RasMol ]  +environment [ RasMol ]
    AD2  [ RasMol ]  +environment [ RasMol ]
    AD3  [ RasMol ]  +environment [ RasMol ]
    AD4  [ RasMol ]  +environment [ RasMol ]
    AD5  [ RasMol ]  +environment [ RasMol ]
    AD6  [ RasMol ]  +environment [ RasMol ]
    AD7  [ RasMol ]  +environment [ RasMol ]
    AD8  [ RasMol ]  +environment [ RasMol ]
    AD9  [ RasMol ]  +environment [ RasMol ]
    AE1  [ RasMol ]  +environment [ RasMol ]
    AE2  [ RasMol ]  +environment [ RasMol ]
    AE3  [ RasMol ]  +environment [ RasMol ]
    AE4  [ RasMol ]  +environment [ RasMol ]
    AE5  [ RasMol ]  +environment [ RasMol ]
    AE6  [ RasMol ]  +environment [ RasMol ]
    AE7  [ RasMol ]  +environment [ RasMol ]
    AE8  [ RasMol ]  +environment [ RasMol ]
    AE9  [ RasMol ]  +environment [ RasMol ]
    AF1  [ RasMol ]  +environment [ RasMol ]
    AF2  [ RasMol ]  +environment [ RasMol ]
    AF3  [ RasMol ]  +environment [ RasMol ]
    AF4  [ RasMol ]  +environment [ RasMol ]
    AF5  [ RasMol ]  +environment [ RasMol ]
    AF6  [ RasMol ]  +environment [ RasMol ]
    AF7  [ RasMol ]  +environment [ RasMol ]
    AF8  [ RasMol ]  +environment [ RasMol ]
    AF9  [ RasMol ]  +environment [ RasMol ]
    AG1  [ RasMol ]  +environment [ RasMol ]
    AG2  [ RasMol ]  +environment [ RasMol ]
    AG3  [ RasMol ]  +environment [ RasMol ]
    AG4  [ RasMol ]  +environment [ RasMol ]
    AG5  [ RasMol ]  +environment [ RasMol ]
    AG6  [ RasMol ]  +environment [ RasMol ]
    AG7  [ RasMol ]  +environment [ RasMol ]
 
  Cis Peptide Bonds
    Ala A:43 - Pro A:44   [ RasMol ]  
    Ala A:72 - Pro A:73   [ RasMol ]  
    Ala B:72 - Pro B:73   [ RasMol ]  
    Ala C:72 - Pro C:73   [ RasMol ]  
    Ala D:72 - Pro D:73   [ RasMol ]  
    Ala E:72 - Pro E:73   [ RasMol ]  
    Ala F:72 - Pro F:73   [ RasMol ]  
    Ala G:72 - Pro G:73   [ RasMol ]  
    Ala H:43 - Pro H:44   [ RasMol ]  
    Ala H:72 - Pro H:73   [ RasMol ]  
    Arg C:214 - Pro C:215   [ RasMol ]  
    Asn E:51 - Pro E:52   [ RasMol ]  
    Gln B:151 - Gly B:152   [ RasMol ]  
    Ile C:146 - Pro C:147   [ RasMol ]  
    Pro D:222 - Pro D:223   [ RasMol ]  
    Pro H:222 - Pro H:223   [ RasMol ]  
    Ser A:42 - Ala A:43   [ RasMol ]  
    Ser H:42 - Ala H:43   [ RasMol ]  
 

(-) Still Images

Jmol
  protein: cartoon or spacefill or dots and stick; nucleic acid: cartoon and stick; ligands: spacefill; active site: stick
Molscript
  protein, nucleic acid: cartoon; ligands: spacefill; active site: ball and stick

 Databases and Analysis Tools

(-) Databases

Access by PDB/NDB ID
  5ejk
    Family and Domain InformationProDom | SYSTERS
    General Structural InformationGlycoscienceDB | MMDB | NDB | OCA | PDB | PDBe | PDBj | PDBsum | PDBWiki | PQS | PROTEOPEDIA
    Orientation in MembranesOPM
    Protein SurfaceSURFACE
    Secondary StructureDSSP (structure derived) | HSSP (homology derived)
    Structural GenomicsGeneCensus
    Structural NeighboursCE | VAST
    Structure ClassificationCATH | Dali | SCOP
    Validation and Original DataBMRB Data View | BMRB Restraints Grid | EDS | PROCHECK | RECOORD | WHAT_CHECK
 
Access by UniProt ID/Accession number
  POL_RSVP | P03354
    Comparative Protein Structure ModelsModBase
    Genomic InformationEnsembl
    Protein-protein InteractionDIP
    Sequence, Family and Domain InformationInterPro | Pfam | SMART | UniProtKB/SwissProt
 
Access by Enzyme Classificator   (EC Number)
  2.7.7.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  2.7.7.49
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  2.7.7.7
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.1.-.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.1.26.4
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
  3.4.23.-
    General Enzyme InformationBRENDA | EC-PDB | Enzyme | IntEnz
    PathwayKEGG | MetaCyc
 
Access by Disease Identifier   (MIM ID)
  (no 'MIM ID' available)
    Disease InformationOMIM
 
Access by GenAge ID
  (no 'GenAge ID' available)
    Age Related InformationGenAge

(-) Analysis Tools

Access by PDB/NDB ID
    Domain InformationXDom
    Interatomic Contacts of Structural UnitsCSU
    Ligand-protein ContactsLPC
    Protein CavitiescastP
    Sequence and Secondary StructurePDBCartoon
    Structure AlignmentSTRAP(Java WebStart application, automatic local installation, requires Java; full application with system access!)
    Structure and Sequence BrowserSTING
 
Access by UniProt ID/Accession number
  POL_RSVP | P03354
    Protein Disorder PredictionDisEMBL | FoldIndex | GLOBPLOT (for more information see DisProt)

 Related Entries

(-) Entries Sharing at Least One Protein Chain (UniProt ID)

UniProtKB/Swiss-Prot
        POL_RSVP | P033541a5v 1a5w 1a5x 1asu 1asv 1asw 1bai 1c0m 1c1a 1cxq 1cxu 1cz9 1czb 1vsd 1vse 1vsf 1vsh 1vsi 1vsj 1vsk 1vsl 1vsm 3tir 4fw1 4fw2

(-) Related Entries Specified in the PDB File

(no "Related Entries Specified in the PDB File" available for 5EJK)